Statistics
Number of enzymes: 1
Total Number of designed primers: 3
Number of PGTM primers: 1
Number of PMTM primers: 2
Number of Failed designed PMTM primers: 1
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103319095 NCBI Gene Symbol: LOC103319095 |
| Gene Aliases | |
| Gene description & Other designations | Description: cysteine desulfurase 1; chloroplastic Other designations: cysteine desulfurase 1; chloroplastic|cysteine desulfurase 2; chloroplastic |
| Chromosome, Strand & Exon count | Chromosome: LG2 Strand: plus Exon count: 11 |
| Gene Location within genomic sequence | Genomic accession No. NC_024127.1 Gene Start and end within genomic accession: 1680564 ...... 1685552 |
| CDS Sequence | 103319095 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Penta Repeat sequence: (GACCC)2 |
| Repeat start & end within CDS | Repeat start: 183 Repeat end: 192 |
| Forward primer | Primer sequence: AATCATACGAAGCCCTGCCC Tm(°C): 60.179 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: GCTTTTGGGAAGTTGCAGCA Tm(°C): 59.895 GC (%): 50 Size: 20 |
| Primer start, end within sequence and product size | Start: 53 End: 267 Product size (bp): 215 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103319095 NCBI Gene Symbol: LOC103319095 |
| Gene Aliases | |
| Gene description & Other designations | Description: cysteine desulfurase 1; chloroplastic Other designations: cysteine desulfurase 1; chloroplastic|cysteine desulfurase 2; chloroplastic |
| Chromosome, Strand & Exon count | Chromosome: LG2 Strand: plus Exon count: 11 |
| Gene Location within genomic sequence | Genomic accession No. NC_024127.1 Gene Start and end within genomic accession: 1680564 ...... 1685552 |
| CDS Sequence | 103319095 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Penta Repeat sequence: (GTTCT)2 |
| Repeat start & end within CDS | Repeat start: 695 Repeat end: 704 |
| Forward primer | Primer sequence: GACCGGCGCTGTTTTGAAAT Tm(°C): 60.04 GC (%): 50 Size: 20 |
| Reverse primer | Primer sequence: CAAGAATCCAACGCCTGTGG Tm(°C): 59.477 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 569 End: 869 Product size (bp): 301 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103319095 NCBI Gene Symbol: LOC103319095 |
| Gene Aliases | |
| Gene description & Other designations | Description: cysteine desulfurase 1; chloroplastic Other designations: cysteine desulfurase 1; chloroplastic|cysteine desulfurase 2; chloroplastic |
| Chromosome, Strand & Exon count | Chromosome: LG2 Strand: plus Exon count: 11 |
| Gene Location within genomic sequence | Genomic accession No. NC_024127.1 Gene Start and end within genomic accession: 1680564 ...... 1685552 |
| CDS Sequence | 103319095 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Tri Repeat sequence: (ATG)3 |
| Repeat start & end within CDS | Repeat start: 1 Repeat end: 9 |
| Forward primer | Primer sequence: None Tm(°C): GC (%): Size: |
| Reverse primer | Primer sequence: None Tm(°C): GC (%): Size: |
| Primer start, end within sequence and product size | Start: End: Product size (bp): |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103319095 NCBI Gene Symbol: LOC103319095 |
| Gene Aliases | |
| Gene description & Other designations | Description: cysteine desulfurase 1; chloroplastic Other designations: cysteine desulfurase 1; chloroplastic|cysteine desulfurase 2; chloroplastic |
| Chromosome, Strand & Exon count | Chromosome: LG2 Strand: plus Exon count: 11 |
| Gene Location within genomic sequence | Genomic accession No. NC_024127.1 Gene Start and end within genomic accession: 1680564 ...... 1685552 |
| CDS Sequence | 103319095 |
| Marker Information | |
| Marker Type | PGTM |
| Repeat type & sequence | Repeat type: Repeat sequence: |
| Repeat start & end within CDS | Repeat start: Repeat end: |
| Forward primer | Primer sequence: CCTGCCCCCTCAAATCATGT Tm(°C): 60.033 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: TCGATGAAGAGGTTGGGCAC Tm(°C): 60.036 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 1134 End: 1280 Product size (bp): 147 |
| JBrowse View | JBrowse |
