image


Statistics

Number of enzymes: 1
Total Number of designed primers: 2
Number of PGTM primers:     1
Number of PMTM primers:     1

Enzyme Id:  K11352

Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103333506     NCBI Gene Symbol: LOC103333506
Gene Aliases
Gene description & Other designations Description:   probable NADH dehydrogenase [ubiquinone] 1 alpha subcomplex subunit 12      Other designations:   probable NADH dehydrogenase [ubiquinone] 1 alpha subcomplex subunit 12
Chromosome, Strand & Exon count Chromosome:   LG5     Strand:   minus     Exon count:   5
Gene Location within genomic sequence Genomic accession No. NC_024130.1      Gene Start and end within genomic accession: 24825534 ...... 24828377
CDS Sequence 103333506
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Di     Repeat sequence: (AG)5
Repeat start & end within CDS Repeat start: 37     Repeat end: 46
Forward primer Primer sequence:   GTGAAGAGCGTTGTGAAGGC     Tm(°C): 59.764     GC (%): 55     Size: 20
Reverse primer Primer sequence:   TACAAGCCTTGCCCCAATGT     Tm(°C): 59.886     GC (%): 50     Size: 20
Primer start, end within sequence and product size Start: 12     End: 152     Product size (bp): 141
JBrowse View      JBrowse

Enzyme Id:  K11352

Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103333506     NCBI Gene Symbol: LOC103333506
Gene Aliases
Gene description & Other designations Description:   probable NADH dehydrogenase [ubiquinone] 1 alpha subcomplex subunit 12      Other designations:   probable NADH dehydrogenase [ubiquinone] 1 alpha subcomplex subunit 12
Chromosome, Strand & Exon count Chromosome:   LG5     Strand:   minus     Exon count:   5
Gene Location within genomic sequence Genomic accession No. NC_024130.1      Gene Start and end within genomic accession: 24825534 ...... 24828377
CDS Sequence 103333506
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   ACATTGGGGCAAGGCTTGTA     Tm(°C): 59.886     GC (%): 50     Size: 20
Reverse primer Primer sequence:   AACCATGCCATTCTGGTGGT     Tm(°C): 59.885     GC (%): 50     Size: 20
Primer start, end within sequence and product size Start: 133     End: 279     Product size (bp): 147
JBrowse View      JBrowse