|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 101262299 NCBI Gene Symbol: LOC101262299 |
| Gene Aliases | CHLP; GGR |
| Gene description & Other designations | Description: geranylgeranyl diphosphate reductase; chloroplastic Other designations: geranylgeranyl diphosphate reductase; chloroplastic|geranylgeranyl reductase |
| Chromosome, Strand & Exon count | Chromosome: 3 Strand: plus Exon count: 1 |
| Gene Location within genomic sequence | Genomic accession No. NC_015440.3 Gene Start and end within genomic accession: 67020137 ...... 67021793 |
| CDS Sequence | 101262299 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Penta Repeat sequence: (CTACA)2 |
| Repeat start & end within CDS | Repeat start: 544 Repeat end: 553 |
| Forward primer | Primer sequence: TATATCGGTATGGTGCGCCG Tm(°C): 59.828 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: GATGGATTTTGCGACACGGG Tm(°C): 59.901 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 411 End: 656 Product size (bp): 246 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 101262299 NCBI Gene Symbol: LOC101262299 |
| Gene Aliases | CHLP; GGR |
| Gene description & Other designations | Description: geranylgeranyl diphosphate reductase; chloroplastic Other designations: geranylgeranyl diphosphate reductase; chloroplastic|geranylgeranyl reductase |
| Chromosome, Strand & Exon count | Chromosome: 3 Strand: plus Exon count: 1 |
| Gene Location within genomic sequence | Genomic accession No. NC_015440.3 Gene Start and end within genomic accession: 67020137 ...... 67021793 |
| CDS Sequence | 101262299 |
| Marker Information | |
| Marker Type | PGTM |
| Repeat type & sequence | Repeat type: Repeat sequence: |
| Repeat start & end within CDS | Repeat start: Repeat end: |
| Forward primer | Primer sequence: ATGTCGGCGATGACGTATCC Tm(°C): 60.039 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: CCTGCTGCATCCCCAACTAA Tm(°C): 60.034 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 751 End: 997 Product size (bp): 247 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 101266160 NCBI Gene Symbol: LOC101266160 |
| Gene Aliases | |
| Gene description & Other designations | Description: geranylgeranyl diphosphate reductase; chloroplastic-like Other designations: geranylgeranyl diphosphate reductase; chloroplastic-like |
| Chromosome, Strand & Exon count | Chromosome: 1 Strand: plus Exon count: 1 |
| Gene Location within genomic sequence | Genomic accession No. NC_015438.3 Gene Start and end within genomic accession: 82958484 ...... 82960100 |
| CDS Sequence | 101266160 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Tri Repeat sequence: (CGG)3 |
| Repeat start & end within CDS | Repeat start: 135 Repeat end: 143 |
| Forward primer | Primer sequence: GGCCGCCCAAACTTACTTTC Tm(°C): 59.757 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: CTGTAGCTGGGCTTCGTTCA Tm(°C): 60.037 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 2 End: 222 Product size (bp): 221 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 101266160 NCBI Gene Symbol: LOC101266160 |
| Gene Aliases | |
| Gene description & Other designations | Description: geranylgeranyl diphosphate reductase; chloroplastic-like Other designations: geranylgeranyl diphosphate reductase; chloroplastic-like |
| Chromosome, Strand & Exon count | Chromosome: 1 Strand: plus Exon count: 1 |
| Gene Location within genomic sequence | Genomic accession No. NC_015438.3 Gene Start and end within genomic accession: 82958484 ...... 82960100 |
| CDS Sequence | 101266160 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Penta Repeat sequence: (AGCCA)2 |
| Repeat start & end within CDS | Repeat start: 222 Repeat end: 231 |
| Forward primer | Primer sequence: CGGCGGAATCGAAACTTTCC Tm(°C): 59.904 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: GTACGGCTCGAGTGAGGATG Tm(°C): 59.97 GC (%): 60 Size: 20 |
| Primer start, end within sequence and product size | Start: 179 End: 500 Product size (bp): 322 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 101266160 NCBI Gene Symbol: LOC101266160 |
| Gene Aliases | |
| Gene description & Other designations | Description: geranylgeranyl diphosphate reductase; chloroplastic-like Other designations: geranylgeranyl diphosphate reductase; chloroplastic-like |
| Chromosome, Strand & Exon count | Chromosome: 1 Strand: plus Exon count: 1 |
| Gene Location within genomic sequence | Genomic accession No. NC_015438.3 Gene Start and end within genomic accession: 82958484 ...... 82960100 |
| CDS Sequence | 101266160 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Tri Repeat sequence: (TCG)3 |
| Repeat start & end within CDS | Repeat start: 335 Repeat end: 343 |
| Forward primer | Primer sequence: TGAACGAAGCCCAGCTACAG Tm(°C): 60.037 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: GTACGGCTCGAGTGAGGATG Tm(°C): 59.97 GC (%): 60 Size: 20 |
| Primer start, end within sequence and product size | Start: 203 End: 500 Product size (bp): 298 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 101266160 NCBI Gene Symbol: LOC101266160 |
| Gene Aliases | |
| Gene description & Other designations | Description: geranylgeranyl diphosphate reductase; chloroplastic-like Other designations: geranylgeranyl diphosphate reductase; chloroplastic-like |
| Chromosome, Strand & Exon count | Chromosome: 1 Strand: plus Exon count: 1 |
| Gene Location within genomic sequence | Genomic accession No. NC_015438.3 Gene Start and end within genomic accession: 82958484 ...... 82960100 |
| CDS Sequence | 101266160 |
| Marker Information | |
| Marker Type | PGTM |
| Repeat type & sequence | Repeat type: Repeat sequence: |
| Repeat start & end within CDS | Repeat start: Repeat end: |
| Forward primer | Primer sequence: CATCCTCACTCGAGCCGTAC Tm(°C): 59.97 GC (%): 60 Size: 20 |
| Reverse primer | Primer sequence: GCTCTGGTATGGGATGAGCC Tm(°C): 59.964 GC (%): 60 Size: 20 |
| Primer start, end within sequence and product size | Start: 481 End: 882 Product size (bp): 402 |
| JBrowse View | JBrowse |
