Statistics
Number of enzymes: 1
Total Number of designed primers: 3
Number of PGTM primers: 1
Number of PMTM primers: 2
Number of Failed designed PMTM primers: 1
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: PHAVU_005G033000g NCBI Gene Symbol: PHAVU_005G033000g |
| Gene Aliases | PHAVU_005G033000g |
| Gene description & Other designations | Description: hypothetical protein Other designations: hypothetical protein |
| Chromosome, Strand & Exon count | Chromosome: 5 Strand: minus Exon count: 16 |
| Gene Location within genomic sequence | Genomic accession No. NC_023755.1 Gene Start and end within genomic accession: 3037611 ...... 3050454 |
| CDS Sequence | PHAVU_005G033000g |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Penta Repeat sequence: (TCAAG)2 |
| Repeat start & end within CDS | Repeat start: 186 Repeat end: 195 |
| Forward primer | Primer sequence: GTCTGTAGCTCCCAAACCCC Tm(°C): 60.035 GC (%): 60 Size: 20 |
| Reverse primer | Primer sequence: CCTTTCCCTTTTTCTGGCGC Tm(°C): 60.038 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 141 End: 457 Product size (bp): 317 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: PHAVU_005G033000g NCBI Gene Symbol: PHAVU_005G033000g |
| Gene Aliases | PHAVU_005G033000g |
| Gene description & Other designations | Description: hypothetical protein Other designations: hypothetical protein |
| Chromosome, Strand & Exon count | Chromosome: 5 Strand: minus Exon count: 16 |
| Gene Location within genomic sequence | Genomic accession No. NC_023755.1 Gene Start and end within genomic accession: 3037611 ...... 3050454 |
| CDS Sequence | PHAVU_005G033000g |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Penta Repeat sequence: (GGAAA)2 |
| Repeat start & end within CDS | Repeat start: 452 Repeat end: 461 |
| Forward primer | Primer sequence: TGCCAATTGCGCCAGAAAAA Tm(°C): 59.894 GC (%): 45 Size: 20 |
| Reverse primer | Primer sequence: AGGCTTCTTTTGCTGGGTCA Tm(°C): 59.814 GC (%): 50 Size: 20 |
| Primer start, end within sequence and product size | Start: 430 End: 758 Product size (bp): 329 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: PHAVU_005G033000g NCBI Gene Symbol: PHAVU_005G033000g |
| Gene Aliases | PHAVU_005G033000g |
| Gene description & Other designations | Description: hypothetical protein Other designations: hypothetical protein |
| Chromosome, Strand & Exon count | Chromosome: 5 Strand: minus Exon count: 16 |
| Gene Location within genomic sequence | Genomic accession No. NC_023755.1 Gene Start and end within genomic accession: 3037611 ...... 3050454 |
| CDS Sequence | PHAVU_005G033000g |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Penta Repeat sequence: (GGTGC)2 |
| Repeat start & end within CDS | Repeat start: 18 Repeat end: 27 |
| Forward primer | Primer sequence: None Tm(°C): GC (%): Size: |
| Reverse primer | Primer sequence: None Tm(°C): GC (%): Size: |
| Primer start, end within sequence and product size | Start: End: Product size (bp): |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: PHAVU_005G033000g NCBI Gene Symbol: PHAVU_005G033000g |
| Gene Aliases | PHAVU_005G033000g |
| Gene description & Other designations | Description: hypothetical protein Other designations: hypothetical protein |
| Chromosome, Strand & Exon count | Chromosome: 5 Strand: minus Exon count: 16 |
| Gene Location within genomic sequence | Genomic accession No. NC_023755.1 Gene Start and end within genomic accession: 3037611 ...... 3050454 |
| CDS Sequence | PHAVU_005G033000g |
| Marker Information | |
| Marker Type | PGTM |
| Repeat type & sequence | Repeat type: Repeat sequence: |
| Repeat start & end within CDS | Repeat start: Repeat end: |
| Forward primer | Primer sequence: TTCATCTGACCACCCCATGC Tm(°C): 60.034 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: TCCAACTGGCAATCGTCGAA Tm(°C): 59.966 GC (%): 50 Size: 20 |
| Primer start, end within sequence and product size | Start: 1055 End: 1289 Product size (bp): 235 |
| JBrowse View | JBrowse |
