image


Statistics

Number of enzymes: 1
Total Number of designed primers: 6
Number of PGTM primers:     2
Number of PMTM primers:     4
Number of Failed designed PMTM primers: 2

Enzyme Id:  K08917
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   104600097     NCBI Gene Symbol: LOC104600097
Gene Aliases
Gene description & Other designations Description:   chlorophyll a-b binding protein CP24 10A; chloroplastic-like      Other designations:   chlorophyll a-b binding protein CP24 10A; chloroplastic-like
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 104600097
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (ATGGG)2
Repeat start & end within CDS Repeat start: 466     Repeat end: 475
Forward primer Primer sequence:   GATCCTGAGTGGCTCGATGG     Tm(°C): 59.967     GC (%): 60     Size: 20
Reverse primer Primer sequence:   TCGACCCACCTCTTGCTTTC     Tm(°C): 59.965     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 213     End: 496     Product size (bp): 284
JBrowse View      JBrowse

Enzyme Id:  K08917
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   104600097     NCBI Gene Symbol: LOC104600097
Gene Aliases
Gene description & Other designations Description:   chlorophyll a-b binding protein CP24 10A; chloroplastic-like      Other designations:   chlorophyll a-b binding protein CP24 10A; chloroplastic-like
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 104600097
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (TGCTA)2
Repeat start & end within CDS Repeat start: 711     Repeat end: 720
Forward primer Primer sequence:   TCATGGGATGGGTGGAAAGC     Tm(°C): 60.033     GC (%): 55     Size: 20
Reverse primer Primer sequence:   GTCTTCCCTTGACCAGCCTC     Tm(°C): 60.036     GC (%): 60     Size: 20
Primer start, end within sequence and product size Start: 463     End: 760     Product size (bp): 298
JBrowse View      JBrowse

Enzyme Id:  K08917
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   104600097     NCBI Gene Symbol: LOC104600097
Gene Aliases
Gene description & Other designations Description:   chlorophyll a-b binding protein CP24 10A; chloroplastic-like      Other designations:   chlorophyll a-b binding protein CP24 10A; chloroplastic-like
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 104600097
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (CTG)3
Repeat start & end within CDS Repeat start: 20     Repeat end: 28
Forward primer Primer sequence:   None     Tm(°C):      GC (%):      Size:
Reverse primer Primer sequence:   None     Tm(°C):      GC (%):      Size:
Primer start, end within sequence and product size Start:      End:      Product size (bp):
JBrowse View      JBrowse

Enzyme Id:  K08917
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   104600097     NCBI Gene Symbol: LOC104600097
Gene Aliases
Gene description & Other designations Description:   chlorophyll a-b binding protein CP24 10A; chloroplastic-like      Other designations:   chlorophyll a-b binding protein CP24 10A; chloroplastic-like
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 104600097
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   GATCCTGAGTGGCTCGATGG     Tm(°C): 59.967     GC (%): 60     Size: 20
Reverse primer Primer sequence:   TTTCCACCCATCCCATGAGC     Tm(°C): 60.033     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 213     End: 480     Product size (bp): 268
JBrowse View      JBrowse

Enzyme Id:  K08917
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   104605931     NCBI Gene Symbol: LOC104605931
Gene Aliases
Gene description & Other designations Description:   chlorophyll a-b binding protein CP24 10A; chloroplastic      Other designations:   chlorophyll a-b binding protein CP24 10A; chloroplastic
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 104605931
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (AGCTG)2
Repeat start & end within CDS Repeat start: 306     Repeat end: 315
Forward primer Primer sequence:   CTCCCCGGAAGCTGATTGTT     Tm(°C): 60.035     GC (%): 55     Size: 20
Reverse primer Primer sequence:   TGCCCAAGAGAGAGCCAAAG     Tm(°C): 59.963     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 130     End: 447     Product size (bp): 318
JBrowse View      JBrowse

Enzyme Id:  K08917
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   104605931     NCBI Gene Symbol: LOC104605931
Gene Aliases
Gene description & Other designations Description:   chlorophyll a-b binding protein CP24 10A; chloroplastic      Other designations:   chlorophyll a-b binding protein CP24 10A; chloroplastic
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 104605931
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Compound     Repeat sequence: (CT)4tgggcacccaactcctgctc(ATGGG)2
Repeat start & end within CDS Repeat start: 435     Repeat end: 472
Forward primer Primer sequence:   GGGCAATGGCAGCTGTAGTA     Tm(°C): 60.107     GC (%): 55     Size: 20
Reverse primer Primer sequence:   CCAGCTTCTCCACATCTGGG     Tm(°C): 60.107     GC (%): 60     Size: 20
Primer start, end within sequence and product size Start: 328     End: 669     Product size (bp): 342
JBrowse View      JBrowse

Enzyme Id:  K08917
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   104605931     NCBI Gene Symbol: LOC104605931
Gene Aliases
Gene description & Other designations Description:   chlorophyll a-b binding protein CP24 10A; chloroplastic      Other designations:   chlorophyll a-b binding protein CP24 10A; chloroplastic
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 104605931
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (CTG)3
Repeat start & end within CDS Repeat start: 20     Repeat end: 28
Forward primer Primer sequence:   None     Tm(°C):      GC (%):      Size:
Reverse primer Primer sequence:   None     Tm(°C):      GC (%):      Size:
Primer start, end within sequence and product size Start:      End:      Product size (bp):
JBrowse View      JBrowse

Enzyme Id:  K08917
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   104605931     NCBI Gene Symbol: LOC104605931
Gene Aliases
Gene description & Other designations Description:   chlorophyll a-b binding protein CP24 10A; chloroplastic      Other designations:   chlorophyll a-b binding protein CP24 10A; chloroplastic
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 104605931
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   CTCCCCGGAAGCTGATTGTT     Tm(°C): 60.035     GC (%): 55     Size: 20
Reverse primer Primer sequence:   TGCCCAAGAGAGAGCCAAAG     Tm(°C): 59.963     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 130     End: 447     Product size (bp): 318
JBrowse View      JBrowse