Statistics
Number of enzymes: 1
Total Number of designed primers: 2
Number of PGTM primers: 1
Number of PMTM primers: 1
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 104593925 NCBI Gene Symbol: LOC104593925 |
| Gene Aliases | |
| Gene description & Other designations | Description: chlorophyll a-b binding protein CP26; chloroplastic Other designations: chlorophyll a-b binding protein CP26; chloroplastic |
| Chromosome, Strand & Exon count | Chromosome: Un Strand: Exon count: |
| Gene Location within genomic sequence | Genomic accession No. Gene Start and end within genomic accession: ...... |
| CDS Sequence | 104593925 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Tri Repeat sequence: (TTG)3 |
| Repeat start & end within CDS | Repeat start: 548 Repeat end: 556 |
| Forward primer | Primer sequence: GAAACCTGAGGACTTCGCCA Tm(°C): 59.965 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: GATCTTCTGCGAGCCCCAAT Tm(°C): 60.179 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 341 End: 678 Product size (bp): 338 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 104593925 NCBI Gene Symbol: LOC104593925 |
| Gene Aliases | |
| Gene description & Other designations | Description: chlorophyll a-b binding protein CP26; chloroplastic Other designations: chlorophyll a-b binding protein CP26; chloroplastic |
| Chromosome, Strand & Exon count | Chromosome: Un Strand: Exon count: |
| Gene Location within genomic sequence | Genomic accession No. Gene Start and end within genomic accession: ...... |
| CDS Sequence | 104593925 |
| Marker Information | |
| Marker Type | PGTM |
| Repeat type & sequence | Repeat type: Repeat sequence: |
| Repeat start & end within CDS | Repeat start: Repeat end: |
| Forward primer | Primer sequence: GCTCGGCAACCCTCTAAACT Tm(°C): 60.036 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: TGGCGAAGTCCTCAGGTTTC Tm(°C): 59.965 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 53 End: 360 Product size (bp): 308 |
| JBrowse View | JBrowse |
