Statistics
Number of enzymes: 1
Total Number of designed primers: 4
Number of PGTM primers: 2
Number of PMTM primers: 2
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 104601250 NCBI Gene Symbol: LOC104601250 |
| Gene Aliases | |
| Gene description & Other designations | Description: chlorophyll a-b binding protein CP29.1; chloroplastic-like Other designations: chlorophyll a-b binding protein CP29.1; chloroplastic-like |
| Chromosome, Strand & Exon count | Chromosome: Un Strand: Exon count: |
| Gene Location within genomic sequence | Genomic accession No. Gene Start and end within genomic accession: ...... |
| CDS Sequence | 104601250 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Compound Repeat sequence: (GATTCG)2gaacgaagaaa(TCCCC)2 |
| Repeat start & end within CDS | Repeat start: 89 Repeat end: 121 |
| Forward primer | Primer sequence: TTCTTGGATCCCGCCTTCAC Tm(°C): 60.035 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: TAGGGCTGGAATGGAGTCGA Tm(°C): 60.033 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 34 End: 370 Product size (bp): 337 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 104601250 NCBI Gene Symbol: LOC104601250 |
| Gene Aliases | |
| Gene description & Other designations | Description: chlorophyll a-b binding protein CP29.1; chloroplastic-like Other designations: chlorophyll a-b binding protein CP29.1; chloroplastic-like |
| Chromosome, Strand & Exon count | Chromosome: Un Strand: Exon count: |
| Gene Location within genomic sequence | Genomic accession No. Gene Start and end within genomic accession: ...... |
| CDS Sequence | 104601250 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Penta Repeat sequence: (GTGAT)2 |
| Repeat start & end within CDS | Repeat start: 311 Repeat end: 320 |
| Forward primer | Primer sequence: TGACTACGGATTCGACCCCT Tm(°C): 60.034 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: ATCGTTGCAAGCCAAACACC Tm(°C): 59.968 GC (%): 50 Size: 20 |
| Primer start, end within sequence and product size | Start: 212 End: 396 Product size (bp): 185 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 104601250 NCBI Gene Symbol: LOC104601250 |
| Gene Aliases | |
| Gene description & Other designations | Description: chlorophyll a-b binding protein CP29.1; chloroplastic-like Other designations: chlorophyll a-b binding protein CP29.1; chloroplastic-like |
| Chromosome, Strand & Exon count | Chromosome: Un Strand: Exon count: |
| Gene Location within genomic sequence | Genomic accession No. Gene Start and end within genomic accession: ...... |
| CDS Sequence | 104601250 |
| Marker Information | |
| Marker Type | PGTM |
| Repeat type & sequence | Repeat type: Repeat sequence: |
| Repeat start & end within CDS | Repeat start: Repeat end: |
| Forward primer | Primer sequence: TGACTACGGATTCGACCCCT Tm(°C): 60.034 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: ATCGTTGCAAGCCAAACACC Tm(°C): 59.968 GC (%): 50 Size: 20 |
| Primer start, end within sequence and product size | Start: 212 End: 396 Product size (bp): 185 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 104595012 NCBI Gene Symbol: LOC104595012 |
| Gene Aliases | |
| Gene description & Other designations | Description: chlorophyll a-b binding protein CP29.2; chloroplastic Other designations: chlorophyll a-b binding protein CP29.2; chloroplastic |
| Chromosome, Strand & Exon count | Chromosome: Un Strand: Exon count: |
| Gene Location within genomic sequence | Genomic accession No. Gene Start and end within genomic accession: ...... |
| CDS Sequence | 104595012 |
| Marker Information | |
| Marker Type | PGTM |
| Repeat type & sequence | Repeat type: Repeat sequence: |
| Repeat start & end within CDS | Repeat start: Repeat end: |
| Forward primer | Primer sequence: TCGACTCCATTCCAGCCCTA Tm(°C): 60.033 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: TGATGGTCGTGTGAAGTGGG Tm(°C): 59.965 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 360 End: 849 Product size (bp): 490 |
| JBrowse View | JBrowse |
