image


Statistics

Number of enzymes: 1
Total Number of designed primers: 4
Number of PGTM primers:     2
Number of PMTM primers:     2

Enzyme Id:  K08914
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   104605680     NCBI Gene Symbol: LOC104605680
Gene Aliases
Gene description & Other designations Description:   chlorophyll a-b binding protein 13; chloroplastic      Other designations:   chlorophyll a-b binding protein 13; chloroplastic
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 104605680
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (TATGG)2
Repeat start & end within CDS Repeat start: 146     Repeat end: 155
Forward primer Primer sequence:   ACCGGCAAGTTCACTATGGG     Tm(°C): 60.035     GC (%): 55     Size: 20
Reverse primer Primer sequence:   ATAAACCGGCAGTGTCCCAG     Tm(°C): 60.035     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 117     End: 255     Product size (bp): 139
JBrowse View      JBrowse

Enzyme Id:  K08914
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   104605680     NCBI Gene Symbol: LOC104605680
Gene Aliases
Gene description & Other designations Description:   chlorophyll a-b binding protein 13; chloroplastic      Other designations:   chlorophyll a-b binding protein 13; chloroplastic
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 104605680
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   CTGGGACACTGCCGGTTTAT     Tm(°C): 60.035     GC (%): 55     Size: 20
Reverse primer Primer sequence:   AGATTCTCGAGAGGGCCCTT     Tm(°C): 60.032     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 236     End: 733     Product size (bp): 498
JBrowse View      JBrowse

Enzyme Id:  K08914
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   104612608     NCBI Gene Symbol: LOC104612608
Gene Aliases
Gene description & Other designations Description:   chlorophyll a-b binding protein 13; chloroplastic-like      Other designations:   chlorophyll a-b binding protein 13; chloroplastic-like
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 104612608
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (TATGG)2
Repeat start & end within CDS Repeat start: 149     Repeat end: 158
Forward primer Primer sequence:   ATGGTGGCTACACTCATGGC     Tm(°C): 60.107     GC (%): 55     Size: 20
Reverse primer Primer sequence:   GGTGAGGTATGAGGGGGTCT     Tm(°C): 60.031     GC (%): 60     Size: 20
Primer start, end within sequence and product size Start: 0     End: 215     Product size (bp): 216
JBrowse View      JBrowse

Enzyme Id:  K08914
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   104612608     NCBI Gene Symbol: LOC104612608
Gene Aliases
Gene description & Other designations Description:   chlorophyll a-b binding protein 13; chloroplastic-like      Other designations:   chlorophyll a-b binding protein 13; chloroplastic-like
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 104612608
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   AGACCCCCTCATACCTCACC     Tm(°C): 60.031     GC (%): 60     Size: 20
Reverse primer Primer sequence:   CTCTGAGCGTGGACAAGGTT     Tm(°C): 59.966     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 196     End: 475     Product size (bp): 280
JBrowse View      JBrowse