Statistics
Number of enzymes: 1
Total Number of designed primers: 4
Number of PGTM primers: 2
Number of PMTM primers: 2
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 104594210 NCBI Gene Symbol: LOC104594210 |
| Gene Aliases | |
| Gene description & Other designations | Description: chlorophyll a-b binding protein 151; chloroplastic-like Other designations: chlorophyll a-b binding protein 151; chloroplastic-like |
| Chromosome, Strand & Exon count | Chromosome: Un Strand: Exon count: |
| Gene Location within genomic sequence | Genomic accession No. Gene Start and end within genomic accession: ...... |
| CDS Sequence | 104594210 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Hexa Repeat sequence: (TGAAGG)2 |
| Repeat start & end within CDS | Repeat start: 623 Repeat end: 634 |
| Forward primer | Primer sequence: TGATGGGCTTCGTAGAGGGA Tm(°C): 60.033 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: CAGGTTCTCAATTGGGCCCT Tm(°C): 59.96 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 496 End: 722 Product size (bp): 227 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 104594210 NCBI Gene Symbol: LOC104594210 |
| Gene Aliases | |
| Gene description & Other designations | Description: chlorophyll a-b binding protein 151; chloroplastic-like Other designations: chlorophyll a-b binding protein 151; chloroplastic-like |
| Chromosome, Strand & Exon count | Chromosome: Un Strand: Exon count: |
| Gene Location within genomic sequence | Genomic accession No. Gene Start and end within genomic accession: ...... |
| CDS Sequence | 104594210 |
| Marker Information | |
| Marker Type | PGTM |
| Repeat type & sequence | Repeat type: Repeat sequence: |
| Repeat start & end within CDS | Repeat start: Repeat end: |
| Forward primer | Primer sequence: TGATGGGCTTCGTAGAGGGA Tm(°C): 60.033 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: TCCTTCACCTTCAACTCCGC Tm(°C): 59.965 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 496 End: 634 Product size (bp): 139 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 104606593 NCBI Gene Symbol: LOC104606593 |
| Gene Aliases | |
| Gene description & Other designations | Description: chlorophyll a-b binding protein 151; chloroplastic Other designations: chlorophyll a-b binding protein 151; chloroplastic |
| Chromosome, Strand & Exon count | Chromosome: Un Strand: Exon count: |
| Gene Location within genomic sequence | Genomic accession No. Gene Start and end within genomic accession: ...... |
| CDS Sequence | 104606593 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Hexa Repeat sequence: (TGAAGG)2 |
| Repeat start & end within CDS | Repeat start: 623 Repeat end: 634 |
| Forward primer | Primer sequence: CAGTTTGGTTCAAAGCCGGG Tm(°C): 59.968 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: GGCCCTTTCCGGTGACAATA Tm(°C): 60.035 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 379 End: 708 Product size (bp): 330 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 104606593 NCBI Gene Symbol: LOC104606593 |
| Gene Aliases | |
| Gene description & Other designations | Description: chlorophyll a-b binding protein 151; chloroplastic Other designations: chlorophyll a-b binding protein 151; chloroplastic |
| Chromosome, Strand & Exon count | Chromosome: Un Strand: Exon count: |
| Gene Location within genomic sequence | Genomic accession No. Gene Start and end within genomic accession: ...... |
| CDS Sequence | 104606593 |
| Marker Information | |
| Marker Type | PGTM |
| Repeat type & sequence | Repeat type: Repeat sequence: |
| Repeat start & end within CDS | Repeat start: Repeat end: |
| Forward primer | Primer sequence: TGCGTCGCACAGTAAAGAGT Tm(°C): 59.968 GC (%): 50 Size: 20 |
| Reverse primer | Primer sequence: CCCGGCTTTGAACCAAACTG Tm(°C): 59.968 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 106 End: 398 Product size (bp): 293 |
| JBrowse View | JBrowse |
