image


Statistics

Number of enzymes: 1
Total Number of designed primers: 16
Number of PGTM primers:     5
Number of PMTM primers:     11
Number of Failed designed PMTM primers: 3

Enzyme Id:  K08912
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   104587699     NCBI Gene Symbol: LOC104587699
Gene Aliases
Gene description & Other designations Description:   chlorophyll a-b binding protein of LHCII type 1-like      Other designations:   chlorophyll a-b binding protein of LHCII type 1-like
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 104587699
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (CTCTC)2
Repeat start & end within CDS Repeat start: 22     Repeat end: 31
Forward primer Primer sequence:   TGGCTGCATCTACAATGGCT     Tm(°C): 59.743     GC (%): 50     Size: 20
Reverse primer Primer sequence:   CATGGGCTACCGGATGAGAC     Tm(°C): 59.966     GC (%): 60     Size: 20
Primer start, end within sequence and product size Start: 1     End: 151     Product size (bp): 151
JBrowse View      JBrowse

Enzyme Id:  K08912
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   104587699     NCBI Gene Symbol: LOC104587699
Gene Aliases
Gene description & Other designations Description:   chlorophyll a-b binding protein of LHCII type 1-like      Other designations:   chlorophyll a-b binding protein of LHCII type 1-like
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 104587699
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (GGTGA)2
Repeat start & end within CDS Repeat start: 550     Repeat end: 559
Forward primer Primer sequence:   TGATTCACGCCCAGAGCATT     Tm(°C): 60.035     GC (%): 50     Size: 20
Reverse primer Primer sequence:   AAAGCCTCTGGGTCATCAGC     Tm(°C): 60.035     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 457     End: 622     Product size (bp): 166
JBrowse View      JBrowse

Enzyme Id:  K08912
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   104587699     NCBI Gene Symbol: LOC104587699
Gene Aliases
Gene description & Other designations Description:   chlorophyll a-b binding protein of LHCII type 1-like      Other designations:   chlorophyll a-b binding protein of LHCII type 1-like
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 104587699
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (AAC)3
Repeat start & end within CDS Repeat start: 757     Repeat end: 765
Forward primer Primer sequence:   GCTGATGACCCAGAGGCTTT     Tm(°C): 60.035     GC (%): 55     Size: 20
Reverse primer Primer sequence:   ACGAAGTTTGTGGCGTAGG     Tm(°C): 58.091     GC (%): 52.632     Size: 19
Primer start, end within sequence and product size Start: 603     End: 790     Product size (bp): 188
JBrowse View      JBrowse

Enzyme Id:  K08912
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   104587699     NCBI Gene Symbol: LOC104587699
Gene Aliases
Gene description & Other designations Description:   chlorophyll a-b binding protein of LHCII type 1-like      Other designations:   chlorophyll a-b binding protein of LHCII type 1-like
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 104587699
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   GTCTCATCCGGTAGCCCATG     Tm(°C): 59.966     GC (%): 60     Size: 20
Reverse primer Primer sequence:   AAAGCCTCTGGGTCATCAGC     Tm(°C): 60.035     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 132     End: 622     Product size (bp): 491
JBrowse View      JBrowse

Enzyme Id:  K08912
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   104590449     NCBI Gene Symbol: LOC104590449
Gene Aliases
Gene description & Other designations Description:   chlorophyll a-b binding protein of LHCII type 1-like      Other designations:   chlorophyll a-b binding protein of LHCII type 1-like
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 104590449
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Di     Repeat sequence: (CT)4
Repeat start & end within CDS Repeat start: 20     Repeat end: 27
Forward primer Primer sequence:   ATGGCTGCCTCTACAATGG     Tm(°C): 57.185     GC (%): 52.632     Size: 19
Reverse primer Primer sequence:   GGTTCTTGGCGAAGGTCTCA     Tm(°C): 59.965     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 0     End: 291     Product size (bp): 292
JBrowse View      JBrowse

Enzyme Id:  K08912
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   104590449     NCBI Gene Symbol: LOC104590449
Gene Aliases
Gene description & Other designations Description:   chlorophyll a-b binding protein of LHCII type 1-like      Other designations:   chlorophyll a-b binding protein of LHCII type 1-like
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 104590449
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (GGTGA)2
Repeat start & end within CDS Repeat start: 553     Repeat end: 562
Forward primer Primer sequence:   TGATTCACGCCCAGAGCATT     Tm(°C): 60.035     GC (%): 50     Size: 20
Reverse primer Primer sequence:   GCGTTGTTGTTGACAGGGTC     Tm(°C): 59.971     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 460     End: 769     Product size (bp): 310
JBrowse View      JBrowse

Enzyme Id:  K08912
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   104590449     NCBI Gene Symbol: LOC104590449
Gene Aliases
Gene description & Other designations Description:   chlorophyll a-b binding protein of LHCII type 1-like      Other designations:   chlorophyll a-b binding protein of LHCII type 1-like
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 104590449
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (CAA)3
Repeat start & end within CDS Repeat start: 759     Repeat end: 767
Forward primer Primer sequence:   TGATTCACGCCCAGAGCATT     Tm(°C): 60.035     GC (%): 50     Size: 20
Reverse primer Primer sequence:   CTTGCCCGGAACAAAGTTGG     Tm(°C): 59.968     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 460     End: 803     Product size (bp): 344
JBrowse View      JBrowse

Enzyme Id:  K08912
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   104590449     NCBI Gene Symbol: LOC104590449
Gene Aliases
Gene description & Other designations Description:   chlorophyll a-b binding protein of LHCII type 1-like      Other designations:   chlorophyll a-b binding protein of LHCII type 1-like
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 104590449
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   TGAGACCTTCGCCAAGAACC     Tm(°C): 59.965     GC (%): 55     Size: 20
Reverse primer Primer sequence:   GCGTTGTTGTTGACAGGGTC     Tm(°C): 59.971     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 272     End: 769     Product size (bp): 498
JBrowse View      JBrowse

Enzyme Id:  K08912
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   104592529     NCBI Gene Symbol: LOC104592529
Gene Aliases
Gene description & Other designations Description:   chlorophyll a-b binding protein; chloroplastic-like      Other designations:   chlorophyll a-b binding protein; chloroplastic-like
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 104592529
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (CTCTC)2
Repeat start & end within CDS Repeat start: 31     Repeat end: 40
Forward primer Primer sequence:   ATGGTCATGGCTGCCTTTGT     Tm(°C): 60.252     GC (%): 50     Size: 20
Reverse primer Primer sequence:   TGACCTCAAGCTCACGGTTC     Tm(°C): 59.966     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 0     End: 312     Product size (bp): 313
JBrowse View      JBrowse

Enzyme Id:  K08912
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   104592529     NCBI Gene Symbol: LOC104592529
Gene Aliases
Gene description & Other designations Description:   chlorophyll a-b binding protein; chloroplastic-like      Other designations:   chlorophyll a-b binding protein; chloroplastic-like
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 104592529
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   CCGGCTCCACCTCAAAGAAT     Tm(°C): 60.035     GC (%): 55     Size: 20
Reverse primer Primer sequence:   TGACCTCAAGCTCACGGTTC     Tm(°C): 59.966     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 70     End: 312     Product size (bp): 243
JBrowse View      JBrowse

Enzyme Id:  K08912
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   104610563     NCBI Gene Symbol: LOC104610563
Gene Aliases LHCP
Gene description & Other designations Description:   chlorophyll a-b binding protein of LHCII type 1-like      Other designations:   chlorophyll a-b binding protein of LHCII type 1-like|chlorophyll a/b-binding protein
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 104610563
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (CTCTC)2
Repeat start & end within CDS Repeat start: 31     Repeat end: 40
Forward primer Primer sequence:   GGTCATGGCTGCCTCTGTAA     Tm(°C): 59.747     GC (%): 55     Size: 20
Reverse primer Primer sequence:   TGACCTCAAGCTCACGGTTC     Tm(°C): 59.966     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 2     End: 312     Product size (bp): 311
JBrowse View      JBrowse

Enzyme Id:  K08912
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   104610563     NCBI Gene Symbol: LOC104610563
Gene Aliases LHCP
Gene description & Other designations Description:   chlorophyll a-b binding protein of LHCII type 1-like      Other designations:   chlorophyll a-b binding protein of LHCII type 1-like|chlorophyll a/b-binding protein
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 104610563
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   AGACTCCGTCCTACCTCACC     Tm(°C): 60.034     GC (%): 60     Size: 20
Reverse primer Primer sequence:   ATAGAGTGGGTCAGTCGGCT     Tm(°C): 60.033     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 205     End: 581     Product size (bp): 377
JBrowse View      JBrowse

Enzyme Id:  K08912
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   104610587     NCBI Gene Symbol: LOC104610587
Gene Aliases
Gene description & Other designations Description:   chlorophyll a-b binding protein of LHCII type 1      Other designations:   chlorophyll a-b binding protein of LHCII type 1
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 104610587
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Compound     Repeat sequence: (CTCTC)2catctctggccggaaaggccgtgaagttggccccttccgccgcctct
gaa(CTT)3ggccaagggagggtcaccatgaggaagactgtggt(CAAGCC)2
Repeat start & end within CDS Repeat start: 22     Repeat end: 137
Forward primer Primer sequence:   ATGGCTGCCTCTACAATGG     Tm(°C): 57.185     GC (%): 52.632     Size: 19
Reverse primer Primer sequence:   GCTCACGGTTCTTGGCAAAG     Tm(°C): 60.04     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 0     End: 300     Product size (bp): 301
JBrowse View      JBrowse

Enzyme Id:  K08912
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   104610587     NCBI Gene Symbol: LOC104610587
Gene Aliases
Gene description & Other designations Description:   chlorophyll a-b binding protein of LHCII type 1      Other designations:   chlorophyll a-b binding protein of LHCII type 1
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 104610587
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (GGTGA)2
Repeat start & end within CDS Repeat start: 556     Repeat end: 565
Forward primer Primer sequence:   ATCTTGATGGGCGCTGTTGA     Tm(°C): 60.035     GC (%): 50     Size: 20
Reverse primer Primer sequence:   GCGTTGTTGTTGACAGGGTC     Tm(°C): 59.971     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 507     End: 772     Product size (bp): 266
JBrowse View      JBrowse

Enzyme Id:  K08912
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   104610587     NCBI Gene Symbol: LOC104610587
Gene Aliases
Gene description & Other designations Description:   chlorophyll a-b binding protein of LHCII type 1      Other designations:   chlorophyll a-b binding protein of LHCII type 1
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 104610587
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (CAA)3
Repeat start & end within CDS Repeat start: 762     Repeat end: 770
Forward primer Primer sequence:   ATCTTGATGGGCGCTGTTGA     Tm(°C): 60.035     GC (%): 50     Size: 20
Reverse primer Primer sequence:   CAGGGACAAAGTTGGTTGCG     Tm(°C): 59.969     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 507     End: 801     Product size (bp): 295
JBrowse View      JBrowse

Enzyme Id:  K08912
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   104610587     NCBI Gene Symbol: LOC104610587
Gene Aliases
Gene description & Other designations Description:   chlorophyll a-b binding protein of LHCII type 1      Other designations:   chlorophyll a-b binding protein of LHCII type 1
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 104610587
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   TTGCACGCAATGGTGTCAAG     Tm(°C): 59.969     GC (%): 50     Size: 20
Reverse primer Primer sequence:   GCGTTGTTGTTGACAGGGTC     Tm(°C): 59.971     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 364     End: 772     Product size (bp): 409
JBrowse View      JBrowse

Enzyme Id:  K08912
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   104590455     NCBI Gene Symbol: LOC104590455
Gene Aliases
Gene description & Other designations Description:   chlorophyll a-b binding protein 1D-like      Other designations:   chlorophyll a-b binding protein 1D-like
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 104590455
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Di     Repeat sequence: (CT)4
Repeat start & end within CDS Repeat start: 20     Repeat end: 27
Forward primer Primer sequence:   None     Tm(°C):      GC (%):      Size:
Reverse primer Primer sequence:   None     Tm(°C):      GC (%):      Size:
Primer start, end within sequence and product size Start:      End:      Product size (bp):
JBrowse View      JBrowse

Enzyme Id:  K08912
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   104590455     NCBI Gene Symbol: LOC104590455
Gene Aliases
Gene description & Other designations Description:   chlorophyll a-b binding protein 1D-like      Other designations:   chlorophyll a-b binding protein 1D-like
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 104590455
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (GGTGA)2
Repeat start & end within CDS Repeat start: 415     Repeat end: 424
Forward primer Primer sequence:   None     Tm(°C):      GC (%):      Size:
Reverse primer Primer sequence:   None     Tm(°C):      GC (%):      Size:
Primer start, end within sequence and product size Start:      End:      Product size (bp):
JBrowse View      JBrowse

Enzyme Id:  K08912
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   104590455     NCBI Gene Symbol: LOC104590455
Gene Aliases
Gene description & Other designations Description:   chlorophyll a-b binding protein 1D-like      Other designations:   chlorophyll a-b binding protein 1D-like
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 104590455
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (CAA)3
Repeat start & end within CDS Repeat start: 621     Repeat end: 629
Forward primer Primer sequence:   None     Tm(°C):      GC (%):      Size:
Reverse primer Primer sequence:   None     Tm(°C):      GC (%):      Size:
Primer start, end within sequence and product size Start:      End:      Product size (bp):
JBrowse View      JBrowse