|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 104598101 NCBI Gene Symbol: LOC104598101 |
| Gene Aliases | |
| Gene description & Other designations | Description: chlorophyll a-b binding protein 4; chloroplastic Other designations: chlorophyll a-b binding protein 4; chloroplastic |
| Chromosome, Strand & Exon count | Chromosome: Un Strand: Exon count: |
| Gene Location within genomic sequence | Genomic accession No. Gene Start and end within genomic accession: ...... |
| CDS Sequence | 104598101 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Hexa Repeat sequence: (AAGGAG)2 |
| Repeat start & end within CDS | Repeat start: 598 Repeat end: 609 |
| Forward primer | Primer sequence: CGACCCTCTTCGTGATCGAG Tm(°C): 59.972 GC (%): 60 Size: 20 |
| Reverse primer | Primer sequence: AGAATCCCCTGAGCGTTTGG Tm(°C): 60.035 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 412 End: 753 Product size (bp): 342 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 104598101 NCBI Gene Symbol: LOC104598101 |
| Gene Aliases | |
| Gene description & Other designations | Description: chlorophyll a-b binding protein 4; chloroplastic Other designations: chlorophyll a-b binding protein 4; chloroplastic |
| Chromosome, Strand & Exon count | Chromosome: Un Strand: Exon count: |
| Gene Location within genomic sequence | Genomic accession No. Gene Start and end within genomic accession: ...... |
| CDS Sequence | 104598101 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Penta Repeat sequence: (CACAA)2 |
| Repeat start & end within CDS | Repeat start: 721 Repeat end: 730 |
| Forward primer | Primer sequence: CGACCCTCTTCGTGATCGAG Tm(°C): 59.972 GC (%): 60 Size: 20 |
| Reverse primer | Primer sequence: AGAATCCCCTGAGCGTTTGG Tm(°C): 60.035 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 412 End: 753 Product size (bp): 342 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 104598101 NCBI Gene Symbol: LOC104598101 |
| Gene Aliases | |
| Gene description & Other designations | Description: chlorophyll a-b binding protein 4; chloroplastic Other designations: chlorophyll a-b binding protein 4; chloroplastic |
| Chromosome, Strand & Exon count | Chromosome: Un Strand: Exon count: |
| Gene Location within genomic sequence | Genomic accession No. Gene Start and end within genomic accession: ...... |
| CDS Sequence | 104598101 |
| Marker Information | |
| Marker Type | PGTM |
| Repeat type & sequence | Repeat type: Repeat sequence: |
| Repeat start & end within CDS | Repeat start: Repeat end: |
| Forward primer | Primer sequence: CGACCCTCTTCGTGATCGAG Tm(°C): 59.972 GC (%): 60 Size: 20 |
| Reverse primer | Primer sequence: TGGTTGGCGCAAAATTGAGG Tm(°C): 59.967 GC (%): 50 Size: 20 |
| Primer start, end within sequence and product size | Start: 412 End: 588 Product size (bp): 177 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 104597786 NCBI Gene Symbol: LOC104597786 |
| Gene Aliases | |
| Gene description & Other designations | Description: chlorophyll a-b binding protein 4; chloroplastic-like Other designations: chlorophyll a-b binding protein 4; chloroplastic-like |
| Chromosome, Strand & Exon count | Chromosome: Un Strand: Exon count: |
| Gene Location within genomic sequence | Genomic accession No. Gene Start and end within genomic accession: ...... |
| CDS Sequence | 104597786 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Penta Repeat sequence: (CACAA)2 |
| Repeat start & end within CDS | Repeat start: 721 Repeat end: 730 |
| Forward primer | Primer sequence: None Tm(°C): GC (%): Size: |
| Reverse primer | Primer sequence: None Tm(°C): GC (%): Size: |
| Primer start, end within sequence and product size | Start: End: Product size (bp): |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 104597786 NCBI Gene Symbol: LOC104597786 |
| Gene Aliases | |
| Gene description & Other designations | Description: chlorophyll a-b binding protein 4; chloroplastic-like Other designations: chlorophyll a-b binding protein 4; chloroplastic-like |
| Chromosome, Strand & Exon count | Chromosome: Un Strand: Exon count: |
| Gene Location within genomic sequence | Genomic accession No. Gene Start and end within genomic accession: ...... |
| CDS Sequence | 104597786 |
| Marker Information | |
| Marker Type | PGTM |
| Repeat type & sequence | Repeat type: Repeat sequence: |
| Repeat start & end within CDS | Repeat start: Repeat end: |
| Forward primer | Primer sequence: CCACACAGGCTTCTGCTGTA Tm(°C): 59.965 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: ACCACGCTGGCACATTGATA Tm(°C): 60.036 GC (%): 50 Size: 20 |
| Primer start, end within sequence and product size | Start: 13 End: 375 Product size (bp): 363 |
| JBrowse View | JBrowse |
