Statistics
Number of enzymes: 1
Total Number of designed primers: 3
Number of PGTM primers: 2
Number of PMTM primers: 1
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 108206898 NCBI Gene Symbol: LOC108206898 |
| Gene Aliases | DCAR_005858 |
| Gene description & Other designations | Description: chlorophyllase-1; chloroplastic-like Other designations: chlorophyllase-1; chloroplastic-like |
| Chromosome, Strand & Exon count | Chromosome: 2 Strand: minus Exon count: 2 |
| Gene Location within genomic sequence | Genomic accession No. NC_030382.1 Gene Start and end within genomic accession: 19001405 ...... 19003462 |
| CDS Sequence | 108206898 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Penta Repeat sequence: (CTGGA)2 |
| Repeat start & end within CDS | Repeat start: 313 Repeat end: 322 |
| Forward primer | Primer sequence: TGCGGAGACCAGGAGTTAGA Tm(°C): 59.961 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: CTGTGACCTCCGACTGCAAT Tm(°C): 60.037 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 276 End: 397 Product size (bp): 122 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 108206898 NCBI Gene Symbol: LOC108206898 |
| Gene Aliases | DCAR_005858 |
| Gene description & Other designations | Description: chlorophyllase-1; chloroplastic-like Other designations: chlorophyllase-1; chloroplastic-like |
| Chromosome, Strand & Exon count | Chromosome: 2 Strand: minus Exon count: 2 |
| Gene Location within genomic sequence | Genomic accession No. NC_030382.1 Gene Start and end within genomic accession: 19001405 ...... 19003462 |
| CDS Sequence | 108206898 |
| Marker Information | |
| Marker Type | PGTM |
| Repeat type & sequence | Repeat type: Repeat sequence: |
| Repeat start & end within CDS | Repeat start: Repeat end: |
| Forward primer | Primer sequence: ATTGCAGTCGGAGGTCACAG Tm(°C): 60.037 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: GCAACACTAGGTTCCTCCCC Tm(°C): 60.035 GC (%): 60 Size: 20 |
| Primer start, end within sequence and product size | Start: 378 End: 877 Product size (bp): 500 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 108193833 NCBI Gene Symbol: LOC108193833 |
| Gene Aliases | DCAR_024190 |
| Gene description & Other designations | Description: chlorophyllase-2; chloroplastic Other designations: chlorophyllase-2; chloroplastic |
| Chromosome, Strand & Exon count | Chromosome: 7 Strand: minus Exon count: 2 |
| Gene Location within genomic sequence | Genomic accession No. NC_030387.1 Gene Start and end within genomic accession: 10535350 ...... 10536964 |
| CDS Sequence | 108193833 |
| Marker Information | |
| Marker Type | PGTM |
| Repeat type & sequence | Repeat type: Repeat sequence: |
| Repeat start & end within CDS | Repeat start: Repeat end: |
| Forward primer | Primer sequence: GGTTGCTGGACCGGATACAA Tm(°C): 60.036 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: ACGTATGTCAGCACTGGTGG Tm(°C): 60.037 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 293 End: 562 Product size (bp): 270 |
| JBrowse View | JBrowse |
