image


Statistics

Number of enzymes: 1
Total Number of designed primers: 10
Number of PGTM primers:     4
Number of PMTM primers:     6
Number of Failed designed PMTM primers: 1

Enzyme Id:  K08099
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   101254033     NCBI Gene Symbol: LOC101254033
Gene Aliases
Gene description & Other designations Description:   chlorophyllase-2; chloroplastic      Other designations:   LOW QUALITY PROTEIN: chlorophyllase-2; chloroplastic
Chromosome, Strand & Exon count Chromosome:   9     Strand:   plus     Exon count:   2
Gene Location within genomic sequence Genomic accession No. NC_015446.3      Gene Start and end within genomic accession: 68755389 ...... 68759699
CDS Sequence 101254033
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (TTG)3
Repeat start & end within CDS Repeat start: 254     Repeat end: 262
Forward primer Primer sequence:   TCCTTCTCCTCCAAAGCCAC     Tm(°C): 59.307     GC (%): 55     Size: 20
Reverse primer Primer sequence:   CTATGGCCAGCTAACCCGAG     Tm(°C): 59.966     GC (%): 60     Size: 20
Primer start, end within sequence and product size Start: 113     End: 412     Product size (bp): 300
JBrowse View      JBrowse

Enzyme Id:  K08099
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   101254033     NCBI Gene Symbol: LOC101254033
Gene Aliases
Gene description & Other designations Description:   chlorophyllase-2; chloroplastic      Other designations:   LOW QUALITY PROTEIN: chlorophyllase-2; chloroplastic
Chromosome, Strand & Exon count Chromosome:   9     Strand:   plus     Exon count:   2
Gene Location within genomic sequence Genomic accession No. NC_015446.3      Gene Start and end within genomic accession: 68755389 ...... 68759699
CDS Sequence 101254033
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   CTCGGGTTAGCTGGCCATAG     Tm(°C): 59.966     GC (%): 60     Size: 20
Reverse primer Primer sequence:   TCGGAGCACAAGCAGGAAAT     Tm(°C): 59.963     GC (%): 50     Size: 20
Primer start, end within sequence and product size Start: 393     End: 645     Product size (bp): 253
JBrowse View      JBrowse

Enzyme Id:  K08099
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   101258376     NCBI Gene Symbol: LOC101258376
Gene Aliases
Gene description & Other designations Description:   chlorophyllase-2; chloroplastic      Other designations:   chlorophyllase-2; chloroplastic
Chromosome, Strand & Exon count Chromosome:   6     Strand:   minus     Exon count:   2
Gene Location within genomic sequence Genomic accession No. NC_015443.3      Gene Start and end within genomic accession: 36953615 ...... 36955151
CDS Sequence 101258376
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (TTG)3
Repeat start & end within CDS Repeat start: 245     Repeat end: 253
Forward primer Primer sequence:   ATTGGGACCCCATCAGAAGC     Tm(°C): 59.74     GC (%): 55     Size: 20
Reverse primer Primer sequence:   ACTTTTCCCCCACGGCTATG     Tm(°C): 60.034     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 129     End: 418     Product size (bp): 290
JBrowse View      JBrowse

Enzyme Id:  K08099
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   101258376     NCBI Gene Symbol: LOC101258376
Gene Aliases
Gene description & Other designations Description:   chlorophyllase-2; chloroplastic      Other designations:   chlorophyllase-2; chloroplastic
Chromosome, Strand & Exon count Chromosome:   6     Strand:   minus     Exon count:   2
Gene Location within genomic sequence Genomic accession No. NC_015443.3      Gene Start and end within genomic accession: 36953615 ...... 36955151
CDS Sequence 101258376
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Compound     Repeat sequence: (ATGGA)2(GAAAG)2
Repeat start & end within CDS Repeat start: 494     Repeat end: 513
Forward primer Primer sequence:   CATAGCCGTGGGGGAAAAGT     Tm(°C): 60.034     GC (%): 55     Size: 20
Reverse primer Primer sequence:   CCCCTTTAGGAGCACAAGCA     Tm(°C): 59.962     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 399     End: 645     Product size (bp): 247
JBrowse View      JBrowse

Enzyme Id:  K08099
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   101258376     NCBI Gene Symbol: LOC101258376
Gene Aliases
Gene description & Other designations Description:   chlorophyllase-2; chloroplastic      Other designations:   chlorophyllase-2; chloroplastic
Chromosome, Strand & Exon count Chromosome:   6     Strand:   minus     Exon count:   2
Gene Location within genomic sequence Genomic accession No. NC_015443.3      Gene Start and end within genomic accession: 36953615 ...... 36955151
CDS Sequence 101258376
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   CGACAGCTGAAGTCACCCAT     Tm(°C): 60.037     GC (%): 55     Size: 20
Reverse primer Primer sequence:   TCAACACCGATCAACGCTGA     Tm(°C): 59.967     GC (%): 50     Size: 20
Primer start, end within sequence and product size Start: 304     End: 484     Product size (bp): 181
JBrowse View      JBrowse

Enzyme Id:  K08099
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   101263579     NCBI Gene Symbol: LOC101263579
Gene Aliases
Gene description & Other designations Description:   chlorophyllase-2; chloroplastic      Other designations:   chlorophyllase type 0|chlorophyllase-2; chloroplastic
Chromosome, Strand & Exon count Chromosome:   12     Strand:   plus     Exon count:   4
Gene Location within genomic sequence Genomic accession No. NC_015449.3      Gene Start and end within genomic accession: 183982 ...... 187047
CDS Sequence 101263579
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (CCT)3
Repeat start & end within CDS Repeat start: 189     Repeat end: 197
Forward primer Primer sequence:   AGCTCTTCCTTGCCATGTCC     Tm(°C): 60.035     GC (%): 55     Size: 20
Reverse primer Primer sequence:   TCTGGCAGCACAGAGTTGAG     Tm(°C): 59.966     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 78     End: 328     Product size (bp): 251
JBrowse View      JBrowse

Enzyme Id:  K08099
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   101263579     NCBI Gene Symbol: LOC101263579
Gene Aliases
Gene description & Other designations Description:   chlorophyllase-2; chloroplastic      Other designations:   chlorophyllase type 0|chlorophyllase-2; chloroplastic
Chromosome, Strand & Exon count Chromosome:   12     Strand:   plus     Exon count:   4
Gene Location within genomic sequence Genomic accession No. NC_015449.3      Gene Start and end within genomic accession: 183982 ...... 187047
CDS Sequence 101263579
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Hexa     Repeat sequence: (AAAACA)2
Repeat start & end within CDS Repeat start: 468     Repeat end: 479
Forward primer Primer sequence:   CTCAACTCTGTGCTGCCAGA     Tm(°C): 59.966     GC (%): 55     Size: 20
Reverse primer Primer sequence:   ACACACACCATAGGCTCGTC     Tm(°C): 59.753     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 309     End: 647     Product size (bp): 339
JBrowse View      JBrowse

Enzyme Id:  K08099
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   101263579     NCBI Gene Symbol: LOC101263579
Gene Aliases
Gene description & Other designations Description:   chlorophyllase-2; chloroplastic      Other designations:   chlorophyllase type 0|chlorophyllase-2; chloroplastic
Chromosome, Strand & Exon count Chromosome:   12     Strand:   plus     Exon count:   4
Gene Location within genomic sequence Genomic accession No. NC_015449.3      Gene Start and end within genomic accession: 183982 ...... 187047
CDS Sequence 101263579
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Di     Repeat sequence: (GT)4
Repeat start & end within CDS Repeat start: 641     Repeat end: 648
Forward primer Primer sequence:   AGACATCCAGAAAGTCGCGG     Tm(°C): 60.109     GC (%): 55     Size: 20
Reverse primer Primer sequence:   GCATGATTCACCCCGTTTGG     Tm(°C): 59.827     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 341     End: 679     Product size (bp): 339
JBrowse View      JBrowse

Enzyme Id:  K08099
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   101263579     NCBI Gene Symbol: LOC101263579
Gene Aliases
Gene description & Other designations Description:   chlorophyllase-2; chloroplastic      Other designations:   chlorophyllase type 0|chlorophyllase-2; chloroplastic
Chromosome, Strand & Exon count Chromosome:   12     Strand:   plus     Exon count:   4
Gene Location within genomic sequence Genomic accession No. NC_015449.3      Gene Start and end within genomic accession: 183982 ...... 187047
CDS Sequence 101263579
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   AGCTCTTCCTTGCCATGTCC     Tm(°C): 60.035     GC (%): 55     Size: 20
Reverse primer Primer sequence:   TCTGGCAGCACAGAGTTGAG     Tm(°C): 59.966     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 78     End: 328     Product size (bp): 251
JBrowse View      JBrowse

Enzyme Id:  K08099
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   101265579     NCBI Gene Symbol: LOC101265579
Gene Aliases
Gene description & Other designations Description:   chlorophyllase-2; chloroplastic      Other designations:   chlorophyllase-1|chlorophyllase-2; chloroplastic
Chromosome, Strand & Exon count Chromosome:   9     Strand:   plus     Exon count:   3
Gene Location within genomic sequence Genomic accession No. NC_015446.3      Gene Start and end within genomic accession: 64017005 ...... 64018954
CDS Sequence 101265579
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Di     Repeat sequence: (AG)4
Repeat start & end within CDS Repeat start: 28     Repeat end: 35
Forward primer Primer sequence:   None     Tm(°C):      GC (%):      Size:
Reverse primer Primer sequence:   None     Tm(°C):      GC (%):      Size:
Primer start, end within sequence and product size Start:      End:      Product size (bp):
JBrowse View      JBrowse

Enzyme Id:  K08099
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   101265579     NCBI Gene Symbol: LOC101265579
Gene Aliases
Gene description & Other designations Description:   chlorophyllase-2; chloroplastic      Other designations:   chlorophyllase-1|chlorophyllase-2; chloroplastic
Chromosome, Strand & Exon count Chromosome:   9     Strand:   plus     Exon count:   3
Gene Location within genomic sequence Genomic accession No. NC_015446.3      Gene Start and end within genomic accession: 64017005 ...... 64018954
CDS Sequence 101265579
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   ACCTCAAATCCGTACTGCCG     Tm(°C): 60.108     GC (%): 55     Size: 20
Reverse primer Primer sequence:   TGTCCAAAGCTACGGCGAAT     Tm(°C): 60.037     GC (%): 50     Size: 20
Primer start, end within sequence and product size Start: 328     End: 432     Product size (bp): 105
JBrowse View      JBrowse