|
| Gene Information | |
NCBI Gene Accession Number & Symbol | Accession Number: 101256945 NCBI Gene Symbol: LOC101256945 |
Gene Aliases | |
Gene description & Other designations | Description: SNW/SKI-interacting protein A Other designations: SNW/SKI-interacting protein A |
Chromosome, Strand & Exon count | Chromosome: 12 Strand: plus Exon count: 2 |
Gene Location within genomic sequence | Genomic accession No. NC_015449.3 Gene Start and end within genomic accession: 1799812 ...... 1803280 |
CDS Sequence | 101256945 |
| Marker Information | |
Marker Type | PMTM |
Repeat type & sequence | Repeat type: Compound Repeat sequence: (CAGAA)2agccagagaagcagttgcaatgcggtcaaaggttcagaaaga(GAT)
3gaaagaaaaggagaagaaagagatagaacttcgggagttggccc(GCAAG)2 |
Repeat start & end within CDS | Repeat start: 911 Repeat end: 1025 |
Forward primer | Primer sequence: TCCCCGTCCAGTTACAGTGA Tm(°C): 60.179 GC (%): 55 Size: 20 |
Reverse primer | Primer sequence: AAGGTACATGTGCAGCAGCT Tm(°C): 59.963 GC (%): 50 Size: 20 |
Primer start, end within sequence and product size | Start: 728 End: 1071 Product size (bp): 344 |
JBrowse View | JBrowse |
|
| Gene Information | |
NCBI Gene Accession Number & Symbol | Accession Number: 101256945 NCBI Gene Symbol: LOC101256945 |
Gene Aliases | |
Gene description & Other designations | Description: SNW/SKI-interacting protein A Other designations: SNW/SKI-interacting protein A |
Chromosome, Strand & Exon count | Chromosome: 12 Strand: plus Exon count: 2 |
Gene Location within genomic sequence | Genomic accession No. NC_015449.3 Gene Start and end within genomic accession: 1799812 ...... 1803280 |
CDS Sequence | 101256945 |
| Marker Information | |
Marker Type | PMTM |
Repeat type & sequence | Repeat type: Compound Repeat sequence: (GAGAGG)3(GGAGA)2* |
Repeat start & end within CDS | Repeat start: 1204 Repeat end: 1224 |
Forward primer | Primer sequence: TGCCCAAAGAATCAAGGGGG Tm(°C): 60.252 GC (%): 55 Size: 20 |
Reverse primer | Primer sequence: GAGTGGGCTGAGCGGTAAAT Tm(°C): 60.108 GC (%): 55 Size: 20 |
Primer start, end within sequence and product size | Start: 1132 End: 1452 Product size (bp): 321 |
JBrowse View | JBrowse |
|
| Gene Information | |
NCBI Gene Accession Number & Symbol | Accession Number: 101256945 NCBI Gene Symbol: LOC101256945 |
Gene Aliases | |
Gene description & Other designations | Description: SNW/SKI-interacting protein A Other designations: SNW/SKI-interacting protein A |
Chromosome, Strand & Exon count | Chromosome: 12 Strand: plus Exon count: 2 |
Gene Location within genomic sequence | Genomic accession No. NC_015449.3 Gene Start and end within genomic accession: 1799812 ...... 1803280 |
CDS Sequence | 101256945 |
| Marker Information | |
Marker Type | PGTM |
Repeat type & sequence | Repeat type: Repeat sequence: |
Repeat start & end within CDS | Repeat start: Repeat end: |
Forward primer | Primer sequence: CGGGTGCAAAGGAGAGGATT Tm(°C): 60.035 GC (%): 55 Size: 20 |
Reverse primer | Primer sequence: ACCTTTGACCGCATTGCAAC Tm(°C): 59.968 GC (%): 50 Size: 20 |
Primer start, end within sequence and product size | Start: 601 End: 952 Product size (bp): 352 |
JBrowse View | JBrowse |
|
| Gene Information | |
NCBI Gene Accession Number & Symbol | Accession Number: 101262885 NCBI Gene Symbol: LOC101262885 |
Gene Aliases | |
Gene description & Other designations | Description: SNW/SKI-interacting protein-like Other designations: SNW/SKI-interacting protein-like |
Chromosome, Strand & Exon count | Chromosome: 11 Strand: plus Exon count: 1 |
Gene Location within genomic sequence | Genomic accession No. NC_015448.3 Gene Start and end within genomic accession: 8034375 ...... 8036425 |
CDS Sequence | 101262885 |
| Marker Information | |
Marker Type | PMTM |
Repeat type & sequence | Repeat type: Penta Repeat sequence: (TACGA)2 |
Repeat start & end within CDS | Repeat start: 67 Repeat end: 76 |
Forward primer | Primer sequence: TGCCTGTTACTGTGGACGAA Tm(°C): 59.246 GC (%): 50 Size: 20 |
Reverse primer | Primer sequence: GGGTGGCTCCATAGGGTCTA Tm(°C): 60.105 GC (%): 60 Size: 20 |
Primer start, end within sequence and product size | Start: 31 End: 362 Product size (bp): 332 |
JBrowse View | JBrowse |
|
| Gene Information | |
NCBI Gene Accession Number & Symbol | Accession Number: 101262885 NCBI Gene Symbol: LOC101262885 |
Gene Aliases | |
Gene description & Other designations | Description: SNW/SKI-interacting protein-like Other designations: SNW/SKI-interacting protein-like |
Chromosome, Strand & Exon count | Chromosome: 11 Strand: plus Exon count: 1 |
Gene Location within genomic sequence | Genomic accession No. NC_015448.3 Gene Start and end within genomic accession: 8034375 ...... 8036425 |
CDS Sequence | 101262885 |
| Marker Information | |
Marker Type | PMTM |
Repeat type & sequence | Repeat type: Tri Repeat sequence: (AGA)3 |
Repeat start & end within CDS | Repeat start: 176 Repeat end: 184 |
Forward primer | Primer sequence: GCGAGACAAGCCGAAAACTC Tm(°C): 59.836 GC (%): 55 Size: 20 |
Reverse primer | Primer sequence: GGGTGGCTCCATAGGGTCTA Tm(°C): 60.105 GC (%): 60 Size: 20 |
Primer start, end within sequence and product size | Start: 78 End: 362 Product size (bp): 285 |
JBrowse View | JBrowse |
|
| Gene Information | |
NCBI Gene Accession Number & Symbol | Accession Number: 101262885 NCBI Gene Symbol: LOC101262885 |
Gene Aliases | |
Gene description & Other designations | Description: SNW/SKI-interacting protein-like Other designations: SNW/SKI-interacting protein-like |
Chromosome, Strand & Exon count | Chromosome: 11 Strand: plus Exon count: 1 |
Gene Location within genomic sequence | Genomic accession No. NC_015448.3 Gene Start and end within genomic accession: 8034375 ...... 8036425 |
CDS Sequence | 101262885 |
| Marker Information | |
Marker Type | PMTM |
Repeat type & sequence | Repeat type: Tri Repeat sequence: (AGC)3 |
Repeat start & end within CDS | Repeat start: 299 Repeat end: 307 |
Forward primer | Primer sequence: GCGAGACAAGCCGAAAACTC Tm(°C): 59.836 GC (%): 55 Size: 20 |
Reverse primer | Primer sequence: GGGTGGCTCCATAGGGTCTA Tm(°C): 60.105 GC (%): 60 Size: 20 |
Primer start, end within sequence and product size | Start: 78 End: 362 Product size (bp): 285 |
JBrowse View | JBrowse |
|
| Gene Information | |
NCBI Gene Accession Number & Symbol | Accession Number: 101262885 NCBI Gene Symbol: LOC101262885 |
Gene Aliases | |
Gene description & Other designations | Description: SNW/SKI-interacting protein-like Other designations: SNW/SKI-interacting protein-like |
Chromosome, Strand & Exon count | Chromosome: 11 Strand: plus Exon count: 1 |
Gene Location within genomic sequence | Genomic accession No. NC_015448.3 Gene Start and end within genomic accession: 8034375 ...... 8036425 |
CDS Sequence | 101262885 |
| Marker Information | |
Marker Type | PMTM |
Repeat type & sequence | Repeat type: Tri Repeat sequence: (CTC)3 |
Repeat start & end within CDS | Repeat start: 425 Repeat end: 433 |
Forward primer | Primer sequence: TGGAGCCACCCAAGTTCAAG Tm(°C): 60.179 GC (%): 55 Size: 20 |
Reverse primer | Primer sequence: GCCAACTCCTGAAGCTCCAT Tm(°C): 60.035 GC (%): 55 Size: 20 |
Primer start, end within sequence and product size | Start: 352 End: 700 Product size (bp): 349 |
JBrowse View | JBrowse |
|
| Gene Information | |
NCBI Gene Accession Number & Symbol | Accession Number: 101262885 NCBI Gene Symbol: LOC101262885 |
Gene Aliases | |
Gene description & Other designations | Description: SNW/SKI-interacting protein-like Other designations: SNW/SKI-interacting protein-like |
Chromosome, Strand & Exon count | Chromosome: 11 Strand: plus Exon count: 1 |
Gene Location within genomic sequence | Genomic accession No. NC_015448.3 Gene Start and end within genomic accession: 8034375 ...... 8036425 |
CDS Sequence | 101262885 |
| Marker Information | |
Marker Type | PMTM |
Repeat type & sequence | Repeat type: Di Repeat sequence: (AG)4 |
Repeat start & end within CDS | Repeat start: 659 Repeat end: 666 |
Forward primer | Primer sequence: GCATTCTCCTCCTCGTCCTG Tm(°C): 59.896 GC (%): 60 Size: 20 |
Reverse primer | Primer sequence: GCCAACTCCTGAAGCTCCAT Tm(°C): 60.035 GC (%): 55 Size: 20 |
Primer start, end within sequence and product size | Start: 419 End: 700 Product size (bp): 282 |
JBrowse View | JBrowse |
|
| Gene Information | |
NCBI Gene Accession Number & Symbol | Accession Number: 101262885 NCBI Gene Symbol: LOC101262885 |
Gene Aliases | |
Gene description & Other designations | Description: SNW/SKI-interacting protein-like Other designations: SNW/SKI-interacting protein-like |
Chromosome, Strand & Exon count | Chromosome: 11 Strand: plus Exon count: 1 |
Gene Location within genomic sequence | Genomic accession No. NC_015448.3 Gene Start and end within genomic accession: 8034375 ...... 8036425 |
CDS Sequence | 101262885 |
| Marker Information | |
Marker Type | PMTM |
Repeat type & sequence | Repeat type: Compound Repeat sequence: (GA)4agataagcaaggagcgacatc(AGGAG)2 |
Repeat start & end within CDS | Repeat start: 771 Repeat end: 809 |
Forward primer | Primer sequence: ATGGAGCTTCAGGAGTTGGC Tm(°C): 60.035 GC (%): 55 Size: 20 |
Reverse primer | Primer sequence: CCATCCCAAGAGCGACCTTT Tm(°C): 60.035 GC (%): 55 Size: 20 |
Primer start, end within sequence and product size | Start: 681 End: 906 Product size (bp): 226 |
JBrowse View | JBrowse |
|
| Gene Information | |
NCBI Gene Accession Number & Symbol | Accession Number: 101262885 NCBI Gene Symbol: LOC101262885 |
Gene Aliases | |
Gene description & Other designations | Description: SNW/SKI-interacting protein-like Other designations: SNW/SKI-interacting protein-like |
Chromosome, Strand & Exon count | Chromosome: 11 Strand: plus Exon count: 1 |
Gene Location within genomic sequence | Genomic accession No. NC_015448.3 Gene Start and end within genomic accession: 8034375 ...... 8036425 |
CDS Sequence | 101262885 |
| Marker Information | |
Marker Type | PMTM |
Repeat type & sequence | Repeat type: Penta Repeat sequence: (TTTGG)2 |
Repeat start & end within CDS | Repeat start: 1198 Repeat end: 1207 |
Forward primer | Primer sequence: None Tm(°C): GC (%): Size: |
Reverse primer | Primer sequence: None Tm(°C): GC (%): Size: |
Primer start, end within sequence and product size | Start: End: Product size (bp): |
JBrowse View | JBrowse |
|
| Gene Information | |
NCBI Gene Accession Number & Symbol | Accession Number: 101262885 NCBI Gene Symbol: LOC101262885 |
Gene Aliases | |
Gene description & Other designations | Description: SNW/SKI-interacting protein-like Other designations: SNW/SKI-interacting protein-like |
Chromosome, Strand & Exon count | Chromosome: 11 Strand: plus Exon count: 1 |
Gene Location within genomic sequence | Genomic accession No. NC_015448.3 Gene Start and end within genomic accession: 8034375 ...... 8036425 |
CDS Sequence | 101262885 |
| Marker Information | |
Marker Type | PGTM |
Repeat type & sequence | Repeat type: Repeat sequence: |
Repeat start & end within CDS | Repeat start: Repeat end: |
Forward primer | Primer sequence: ATGGAGCTTCAGGAGTTGGC Tm(°C): 60.035 GC (%): 55 Size: 20 |
Reverse primer | Primer sequence: CCATCCCAAGAGCGACCTTT Tm(°C): 60.035 GC (%): 55 Size: 20 |
Primer start, end within sequence and product size | Start: 681 End: 906 Product size (bp): 226 |
JBrowse View | JBrowse |