Statistics
Number of enzymes: 1
Total Number of designed primers: 8
Number of PGTM primers: 2
Number of PMTM primers: 6
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 111473275 NCBI Gene Symbol: LOC111473275 |
| Gene Aliases | |
| Gene description & Other designations | Description: CAAX prenyl protease 1 homolog Other designations: CAAX prenyl protease 1 homolog |
| Chromosome, Strand & Exon count | Chromosome: Un Strand: Exon count: |
| Gene Location within genomic sequence | Genomic accession No. Gene Start and end within genomic accession: ...... |
| CDS Sequence | 111473275 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Penta Repeat sequence: (TGTTG)2 |
| Repeat start & end within CDS | Repeat start: 279 Repeat end: 288 |
| Forward primer | Primer sequence: ATGCTGCTCTGAAACTGCCT Tm(°C): 59.962 GC (%): 50 Size: 20 |
| Reverse primer | Primer sequence: TGAAACCATGGCGGGATTCA Tm(°C): 59.961 GC (%): 50 Size: 20 |
| Primer start, end within sequence and product size | Start: 82 End: 420 Product size (bp): 339 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 111473275 NCBI Gene Symbol: LOC111473275 |
| Gene Aliases | |
| Gene description & Other designations | Description: CAAX prenyl protease 1 homolog Other designations: CAAX prenyl protease 1 homolog |
| Chromosome, Strand & Exon count | Chromosome: Un Strand: Exon count: |
| Gene Location within genomic sequence | Genomic accession No. Gene Start and end within genomic accession: ...... |
| CDS Sequence | 111473275 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Tri Repeat sequence: (TGA)3 |
| Repeat start & end within CDS | Repeat start: 584 Repeat end: 592 |
| Forward primer | Primer sequence: TGAATCCCGCCATGGTTTCA Tm(°C): 59.961 GC (%): 50 Size: 20 |
| Reverse primer | Primer sequence: GGGAACTTGAGGGAGGAAGC Tm(°C): 60.035 GC (%): 60 Size: 20 |
| Primer start, end within sequence and product size | Start: 401 End: 697 Product size (bp): 297 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 111473275 NCBI Gene Symbol: LOC111473275 |
| Gene Aliases | |
| Gene description & Other designations | Description: CAAX prenyl protease 1 homolog Other designations: CAAX prenyl protease 1 homolog |
| Chromosome, Strand & Exon count | Chromosome: Un Strand: Exon count: |
| Gene Location within genomic sequence | Genomic accession No. Gene Start and end within genomic accession: ...... |
| CDS Sequence | 111473275 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Tri Repeat sequence: (TTG)3 |
| Repeat start & end within CDS | Repeat start: 713 Repeat end: 721 |
| Forward primer | Primer sequence: GCTTCCTCCCTCAAGTTCCC Tm(°C): 60.035 GC (%): 60 Size: 20 |
| Reverse primer | Primer sequence: CAATGCCCCAACTCATGTGC Tm(°C): 60.109 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 678 End: 865 Product size (bp): 188 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 111473275 NCBI Gene Symbol: LOC111473275 |
| Gene Aliases | |
| Gene description & Other designations | Description: CAAX prenyl protease 1 homolog Other designations: CAAX prenyl protease 1 homolog |
| Chromosome, Strand & Exon count | Chromosome: Un Strand: Exon count: |
| Gene Location within genomic sequence | Genomic accession No. Gene Start and end within genomic accession: ...... |
| CDS Sequence | 111473275 |
| Marker Information | |
| Marker Type | PGTM |
| Repeat type & sequence | Repeat type: Repeat sequence: |
| Repeat start & end within CDS | Repeat start: Repeat end: |
| Forward primer | Primer sequence: GCTTCCTCCCTCAAGTTCCC Tm(°C): 60.035 GC (%): 60 Size: 20 |
| Reverse primer | Primer sequence: GTCTGACAAGACCAGCACGA Tm(°C): 59.968 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 678 End: 1152 Product size (bp): 475 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 111479583 NCBI Gene Symbol: LOC111479583 |
| Gene Aliases | |
| Gene description & Other designations | Description: CAAX prenyl protease 1 homolog Other designations: CAAX prenyl protease 1 homolog |
| Chromosome, Strand & Exon count | Chromosome: Un Strand: Exon count: |
| Gene Location within genomic sequence | Genomic accession No. Gene Start and end within genomic accession: ...... |
| CDS Sequence | 111479583 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Tetra Repeat sequence: (AACA)3 |
| Repeat start & end within CDS | Repeat start: 421 Repeat end: 432 |
| Forward primer | Primer sequence: GTTGGTTGGCCTCAATGCTG Tm(°C): 60.038 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: TGGTGGGCCAAGTAAGATGG Tm(°C): 59.669 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 284 End: 494 Product size (bp): 211 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 111479583 NCBI Gene Symbol: LOC111479583 |
| Gene Aliases | |
| Gene description & Other designations | Description: CAAX prenyl protease 1 homolog Other designations: CAAX prenyl protease 1 homolog |
| Chromosome, Strand & Exon count | Chromosome: Un Strand: Exon count: |
| Gene Location within genomic sequence | Genomic accession No. Gene Start and end within genomic accession: ...... |
| CDS Sequence | 111479583 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Tri Repeat sequence: (TGA)3 |
| Repeat start & end within CDS | Repeat start: 584 Repeat end: 592 |
| Forward primer | Primer sequence: TCCATCTTACTTGGCCCACC Tm(°C): 59.376 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: GGGAACTTGAGGGAGGAAGC Tm(°C): 60.035 GC (%): 60 Size: 20 |
| Primer start, end within sequence and product size | Start: 474 End: 697 Product size (bp): 224 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 111479583 NCBI Gene Symbol: LOC111479583 |
| Gene Aliases | |
| Gene description & Other designations | Description: CAAX prenyl protease 1 homolog Other designations: CAAX prenyl protease 1 homolog |
| Chromosome, Strand & Exon count | Chromosome: Un Strand: Exon count: |
| Gene Location within genomic sequence | Genomic accession No. Gene Start and end within genomic accession: ...... |
| CDS Sequence | 111479583 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Tri Repeat sequence: (TTG)3 |
| Repeat start & end within CDS | Repeat start: 713 Repeat end: 721 |
| Forward primer | Primer sequence: GCTTCCTCCCTCAAGTTCCC Tm(°C): 60.035 GC (%): 60 Size: 20 |
| Reverse primer | Primer sequence: TGCCCCAATTCGTGTGCTAT Tm(°C): 60.035 GC (%): 50 Size: 20 |
| Primer start, end within sequence and product size | Start: 678 End: 862 Product size (bp): 185 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 111479583 NCBI Gene Symbol: LOC111479583 |
| Gene Aliases | |
| Gene description & Other designations | Description: CAAX prenyl protease 1 homolog Other designations: CAAX prenyl protease 1 homolog |
| Chromosome, Strand & Exon count | Chromosome: Un Strand: Exon count: |
| Gene Location within genomic sequence | Genomic accession No. Gene Start and end within genomic accession: ...... |
| CDS Sequence | 111479583 |
| Marker Information | |
| Marker Type | PGTM |
| Repeat type & sequence | Repeat type: Repeat sequence: |
| Repeat start & end within CDS | Repeat start: Repeat end: |
| Forward primer | Primer sequence: TAGCACACGAATTGGGGCAT Tm(°C): 60.035 GC (%): 50 Size: 20 |
| Reverse primer | Primer sequence: TCGGCTGACAAGGTTGAGAC Tm(°C): 59.966 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 844 End: 1076 Product size (bp): 233 |
| JBrowse View | JBrowse |
