|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 18668094 NCBI Gene Symbol: ndhG |
| Gene Aliases | CP95_p012 |
| Gene description & Other designations | Description: NADH-plastoquinone oxidoreductase subunit 6 Other designations: |
| Chromosome, Strand & Exon count | Chromosome: Strand: minus Exon count: 0 |
| Gene Location within genomic sequence | Genomic accession No. NC_023798.1 Gene Start and end within genomic accession: 121004 ...... 121534 |
| CDS Sequence | 18668094 |
| Marker Information | |
| Marker Type | PGTM |
| Repeat type & sequence | Repeat type: Repeat sequence: |
| Repeat start & end within CDS | Repeat start: Repeat end: |
| Forward primer | Primer sequence: ATGGATTTGCCCGGACCAAT Tm(°C): 60.032 GC (%): 50 Size: 20 |
| Reverse primer | Primer sequence: CATCCCCAACGGTCCAAAGA Tm(°C): 59.962 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 0 End: 291 Product size (bp): 292 |
| JBrowse View | JBrowse |
