image


Statistics

Number of enzymes: 1
Total Number of designed primers: 4
Number of PGTM primers:     1
Number of PMTM primers:     3

Enzyme Id:  K05572

Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   18668096     NCBI Gene Symbol: ndhA
Gene Aliases CP95_p010
Gene description & Other designations Description:   NADH-plastoquinone oxidoreductase subunit 1      Other designations:   
Chromosome, Strand & Exon count Chromosome:        Strand:   minus     Exon count:   0
Gene Location within genomic sequence Genomic accession No. NC_023798.1      Gene Start and end within genomic accession: 122522 ...... 124751
CDS Sequence 18668096
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (GCT)3
Repeat start & end within CDS Repeat start: 490     Repeat end: 498
Forward primer Primer sequence:   GGGCCATCCATAGCAGTCAT     Tm(°C): 59.597     GC (%): 55     Size: 20
Reverse primer Primer sequence:   GACGCCACAAATTCCATCCC     Tm(°C): 59.544     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 300     End: 630     Product size (bp): 331
JBrowse View      JBrowse

Enzyme Id:  K05572

Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   18668096     NCBI Gene Symbol: ndhA
Gene Aliases CP95_p010
Gene description & Other designations Description:   NADH-plastoquinone oxidoreductase subunit 1      Other designations:   
Chromosome, Strand & Exon count Chromosome:        Strand:   minus     Exon count:   0
Gene Location within genomic sequence Genomic accession No. NC_023798.1      Gene Start and end within genomic accession: 122522 ...... 124751
CDS Sequence 18668096
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Compound     Repeat sequence: (AGA)3attagtagcaggttatcaaaccgaatactcgggtataaaatttgg(TTT
AT)2
Repeat start & end within CDS Repeat start: 708     Repeat end: 771
Forward primer Primer sequence:   GGGATGGAATTTGTGGCGTC     Tm(°C): 59.544     GC (%): 55     Size: 20
Reverse primer Primer sequence:   ACCGATTGTCGCTCCAAAAAC     Tm(°C): 59.734     GC (%): 47.619     Size: 21
Primer start, end within sequence and product size Start: 611     End: 917     Product size (bp): 307
JBrowse View      JBrowse

Enzyme Id:  K05572

Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   18668096     NCBI Gene Symbol: ndhA
Gene Aliases CP95_p010
Gene description & Other designations Description:   NADH-plastoquinone oxidoreductase subunit 1      Other designations:   
Chromosome, Strand & Exon count Chromosome:        Strand:   minus     Exon count:   0
Gene Location within genomic sequence Genomic accession No. NC_023798.1      Gene Start and end within genomic accession: 122522 ...... 124751
CDS Sequence 18668096
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Hexa     Repeat sequence: (TTGTTC)2
Repeat start & end within CDS Repeat start: 946     Repeat end: 957
Forward primer Primer sequence:   GTGGAGTTTTTGGAGCGACA     Tm(°C): 58.695     GC (%): 50     Size: 20
Reverse primer Primer sequence:   TGGTCCATTCTTAGCCTTGGT     Tm(°C): 59.007     GC (%): 47.619     Size: 21
Primer start, end within sequence and product size Start: 892     End: 1003     Product size (bp): 112
JBrowse View      JBrowse

Enzyme Id:  K05572

Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   18668096     NCBI Gene Symbol: ndhA
Gene Aliases CP95_p010
Gene description & Other designations Description:   NADH-plastoquinone oxidoreductase subunit 1      Other designations:   
Chromosome, Strand & Exon count Chromosome:        Strand:   minus     Exon count:   0
Gene Location within genomic sequence Genomic accession No. NC_023798.1      Gene Start and end within genomic accession: 122522 ...... 124751
CDS Sequence 18668096
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   ATTGGACCTGAATACGCCGG     Tm(°C): 60.179     GC (%): 55     Size: 20
Reverse primer Primer sequence:   AGCAGCTCGTAGACCACCTA     Tm(°C): 60.034     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 183     End: 494     Product size (bp): 312
JBrowse View      JBrowse