Statistics
Number of enzymes: 1
Total Number of designed primers: 5
Number of PGTM primers: 2
Number of PMTM primers: 3
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103336548 NCBI Gene Symbol: LOC103336548 |
| Gene Aliases | |
| Gene description & Other designations | Description: alkaline ceramidase 3-like Other designations: alkaline ceramidase 3-like |
| Chromosome, Strand & Exon count | Chromosome: LG6 Strand: minus Exon count: 4 |
| Gene Location within genomic sequence | Genomic accession No. NC_024131.1 Gene Start and end within genomic accession: 20883801 ...... 20887518 |
| CDS Sequence | 103336548 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Tri Repeat sequence: (GCA)3 |
| Repeat start & end within CDS | Repeat start: 252 Repeat end: 260 |
| Forward primer | Primer sequence: GCTTTGAGGCAACGCTTTGA Tm(°C): 59.969 GC (%): 50 Size: 20 |
| Reverse primer | Primer sequence: CAAGAAGGTGGGCATTGTGC Tm(°C): 60.038 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 150 End: 356 Product size (bp): 207 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103336548 NCBI Gene Symbol: LOC103336548 |
| Gene Aliases | |
| Gene description & Other designations | Description: alkaline ceramidase 3-like Other designations: alkaline ceramidase 3-like |
| Chromosome, Strand & Exon count | Chromosome: LG6 Strand: minus Exon count: 4 |
| Gene Location within genomic sequence | Genomic accession No. NC_024131.1 Gene Start and end within genomic accession: 20883801 ...... 20887518 |
| CDS Sequence | 103336548 |
| Marker Information | |
| Marker Type | PGTM |
| Repeat type & sequence | Repeat type: Repeat sequence: |
| Repeat start & end within CDS | Repeat start: Repeat end: |
| Forward primer | Primer sequence: GCTTTGAGGCAACGCTTTGA Tm(°C): 59.969 GC (%): 50 Size: 20 |
| Reverse primer | Primer sequence: AGACTTCCCTGCACAAGACG Tm(°C): 59.966 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 150 End: 582 Product size (bp): 433 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103327002 NCBI Gene Symbol: LOC103327002 |
| Gene Aliases | |
| Gene description & Other designations | Description: alkaline ceramidase 3 Other designations: alkaline ceramidase 3 |
| Chromosome, Strand & Exon count | Chromosome: LG3 Strand: minus Exon count: 3 |
| Gene Location within genomic sequence | Genomic accession No. NC_024128.1 Gene Start and end within genomic accession: 20833175 ...... 20835924 |
| CDS Sequence | 103327002 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Hexa Repeat sequence: (TCTTCC)2 |
| Repeat start & end within CDS | Repeat start: 353 Repeat end: 364 |
| Forward primer | Primer sequence: AAGGCAGCGGTTTGAGAAGA Tm(°C): 59.891 GC (%): 50 Size: 20 |
| Reverse primer | Primer sequence: GCCACAGAATGAACAGCAGC Tm(°C): 60.109 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 158 End: 400 Product size (bp): 243 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103327002 NCBI Gene Symbol: LOC103327002 |
| Gene Aliases | |
| Gene description & Other designations | Description: alkaline ceramidase 3 Other designations: alkaline ceramidase 3 |
| Chromosome, Strand & Exon count | Chromosome: LG3 Strand: minus Exon count: 3 |
| Gene Location within genomic sequence | Genomic accession No. NC_024128.1 Gene Start and end within genomic accession: 20833175 ...... 20835924 |
| CDS Sequence | 103327002 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Di Repeat sequence: (TA)4 |
| Repeat start & end within CDS | Repeat start: 475 Repeat end: 482 |
| Forward primer | Primer sequence: GCTGCTGTTCATTCTGTGGC Tm(°C): 60.109 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: GAGCCCGGCAAAACATCAAG Tm(°C): 60.109 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 381 End: 684 Product size (bp): 304 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103327002 NCBI Gene Symbol: LOC103327002 |
| Gene Aliases | |
| Gene description & Other designations | Description: alkaline ceramidase 3 Other designations: alkaline ceramidase 3 |
| Chromosome, Strand & Exon count | Chromosome: LG3 Strand: minus Exon count: 3 |
| Gene Location within genomic sequence | Genomic accession No. NC_024128.1 Gene Start and end within genomic accession: 20833175 ...... 20835924 |
| CDS Sequence | 103327002 |
| Marker Information | |
| Marker Type | PGTM |
| Repeat type & sequence | Repeat type: Repeat sequence: |
| Repeat start & end within CDS | Repeat start: Repeat end: |
| Forward primer | Primer sequence: GGATCAAGCTTCTGGGGTCC Tm(°C): 60.107 GC (%): 60 Size: 20 |
| Reverse primer | Primer sequence: TCTTCTCAAACCGCTGCCTT Tm(°C): 59.891 GC (%): 50 Size: 20 |
| Primer start, end within sequence and product size | Start: 12 End: 177 Product size (bp): 166 |
| JBrowse View | JBrowse |
