image


Statistics

Number of enzymes: 1
Total Number of designed primers: 3
Number of PGTM primers:     1
Number of PMTM primers:     2

Enzyme Id:  K04040
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   101246752     NCBI Gene Symbol: LOC101246752
Gene Aliases
Gene description & Other designations Description:   chlorophyll synthase; chloroplastic      Other designations:   chlorophyll synthase; chloroplastic
Chromosome, Strand & Exon count Chromosome:   9     Strand:   minus     Exon count:   15
Gene Location within genomic sequence Genomic accession No. NC_015446.3      Gene Start and end within genomic accession: 6841771 ...... 6847509
CDS Sequence 101246752
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (GCT)3
Repeat start & end within CDS Repeat start: 304     Repeat end: 312
Forward primer Primer sequence:   GAGCCAAGCAAGAAACGGAC     Tm(°C): 59.761     GC (%): 55     Size: 20
Reverse primer Primer sequence:   AGCTAACCCAAGGCCTCCTA     Tm(°C): 59.956     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 211     End: 536     Product size (bp): 326
JBrowse View      JBrowse

Enzyme Id:  K04040
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   101246752     NCBI Gene Symbol: LOC101246752
Gene Aliases
Gene description & Other designations Description:   chlorophyll synthase; chloroplastic      Other designations:   chlorophyll synthase; chloroplastic
Chromosome, Strand & Exon count Chromosome:   9     Strand:   minus     Exon count:   15
Gene Location within genomic sequence Genomic accession No. NC_015446.3      Gene Start and end within genomic accession: 6841771 ...... 6847509
CDS Sequence 101246752
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (GGGCA)2
Repeat start & end within CDS Repeat start: 554     Repeat end: 563
Forward primer Primer sequence:   TAGGAGGCCTTGGGTTAGCT     Tm(°C): 59.956     GC (%): 55     Size: 20
Reverse primer Primer sequence:   CCCACCAAGGCAAGCTGATA     Tm(°C): 60.034     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 517     End: 705     Product size (bp): 189
JBrowse View      JBrowse

Enzyme Id:  K04040
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   101246752     NCBI Gene Symbol: LOC101246752
Gene Aliases
Gene description & Other designations Description:   chlorophyll synthase; chloroplastic      Other designations:   chlorophyll synthase; chloroplastic
Chromosome, Strand & Exon count Chromosome:   9     Strand:   minus     Exon count:   15
Gene Location within genomic sequence Genomic accession No. NC_015446.3      Gene Start and end within genomic accession: 6841771 ...... 6847509
CDS Sequence 101246752
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   CCTTGCACTTGGTGGATCCT     Tm(°C): 59.961     GC (%): 55     Size: 20
Reverse primer Primer sequence:   CCCACCAAGGCAAGCTGATA     Tm(°C): 60.034     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 584     End: 705     Product size (bp): 122
JBrowse View      JBrowse