Statistics
Number of enzymes: 1
Total Number of designed primers: 4
Number of PGTM primers: 3
Number of PMTM primers: 1
Number of Failed designed PMTM primers: 1
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103331456 NCBI Gene Symbol: LOC103331456 |
| Gene Aliases | |
| Gene description & Other designations | Description: acyl carrier protein 1; mitochondrial Other designations: acyl carrier protein 1; mitochondrial |
| Chromosome, Strand & Exon count | Chromosome: LG5 Strand: plus Exon count: 2 |
| Gene Location within genomic sequence | Genomic accession No. NC_024130.1 Gene Start and end within genomic accession: 11989991 ...... 11992086 |
| CDS Sequence | 103331456 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Hexa Repeat sequence: (CCCTAA)2 |
| Repeat start & end within CDS | Repeat start: 62 Repeat end: 73 |
| Forward primer | Primer sequence: GCACAAACCCTAAACCCAGC Tm(°C): 59.683 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: TCTCTCGGTGACCTCGGATT Tm(°C): 60.034 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 42 End: 155 Product size (bp): 114 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103331456 NCBI Gene Symbol: LOC103331456 |
| Gene Aliases | |
| Gene description & Other designations | Description: acyl carrier protein 1; mitochondrial Other designations: acyl carrier protein 1; mitochondrial |
| Chromosome, Strand & Exon count | Chromosome: LG5 Strand: plus Exon count: 2 |
| Gene Location within genomic sequence | Genomic accession No. NC_024130.1 Gene Start and end within genomic accession: 11989991 ...... 11992086 |
| CDS Sequence | 103331456 |
| Marker Information | |
| Marker Type | PGTM |
| Repeat type & sequence | Repeat type: Repeat sequence: |
| Repeat start & end within CDS | Repeat start: Repeat end: |
| Forward primer | Primer sequence: CAAACCCTAAACCCAGCCCT Tm(°C): 59.886 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: TCTCTCGGTGACCTCGGATT Tm(°C): 60.034 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 45 End: 155 Product size (bp): 111 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103318813 NCBI Gene Symbol: LOC103318813 |
| Gene Aliases | |
| Gene description & Other designations | Description: acyl carrier protein 2; mitochondrial Other designations: acyl carrier protein 2; mitochondrial |
| Chromosome, Strand & Exon count | Chromosome: LG1 Strand: minus Exon count: 2 |
| Gene Location within genomic sequence | Genomic accession No. NC_024126.1 Gene Start and end within genomic accession: 26504257 ...... 26506461 |
| CDS Sequence | 103318813 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Compound Repeat sequence: (GGC)3tgcgaggagcgcgatacttaagtacctgag(AGTTCC)2 |
| Repeat start & end within CDS | Repeat start: 3 Repeat end: 53 |
| Forward primer | Primer sequence: None Tm(°C): GC (%): Size: |
| Reverse primer | Primer sequence: None Tm(°C): GC (%): Size: |
| Primer start, end within sequence and product size | Start: End: Product size (bp): |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103318813 NCBI Gene Symbol: LOC103318813 |
| Gene Aliases | |
| Gene description & Other designations | Description: acyl carrier protein 2; mitochondrial Other designations: acyl carrier protein 2; mitochondrial |
| Chromosome, Strand & Exon count | Chromosome: LG1 Strand: minus Exon count: 2 |
| Gene Location within genomic sequence | Genomic accession No. NC_024126.1 Gene Start and end within genomic accession: 26504257 ...... 26506461 |
| CDS Sequence | 103318813 |
| Marker Information | |
| Marker Type | PGTM |
| Repeat type & sequence | Repeat type: Repeat sequence: |
| Repeat start & end within CDS | Repeat start: Repeat end: |
| Forward primer | Primer sequence: CCTGAGAGTTCCAGTTCCGG Tm(°C): 59.752 GC (%): 60 Size: 20 |
| Reverse primer | Primer sequence: CCTGACCTCCTCGGAGAAGA Tm(°C): 60.034 GC (%): 60 Size: 20 |
| Primer start, end within sequence and product size | Start: 35 End: 143 Product size (bp): 109 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103324360 NCBI Gene Symbol: LOC103324360 |
| Gene Aliases | |
| Gene description & Other designations | Description: acyl carrier protein 3; mitochondrial Other designations: acyl carrier protein 3; mitochondrial |
| Chromosome, Strand & Exon count | Chromosome: LG3 Strand: plus Exon count: 4 |
| Gene Location within genomic sequence | Genomic accession No. NC_024128.1 Gene Start and end within genomic accession: 67243 ...... 69746 |
| CDS Sequence | 103324360 |
| Marker Information | |
| Marker Type | PGTM |
| Repeat type & sequence | Repeat type: Repeat sequence: |
| Repeat start & end within CDS | Repeat start: Repeat end: |
| Forward primer | Primer sequence: CGCAACAGGTACTACCAGCA Tm(°C): 60.038 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: GCCATAACAAGCTCCACCCT Tm(°C): 60.034 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 116 End: 271 Product size (bp): 156 |
| JBrowse View | JBrowse |
