Statistics
Number of enzymes: 1
Total Number of designed primers: 2
Number of PGTM primers: 1
Number of PMTM primers: 1
|
| Gene Information | |
NCBI Gene Accession Number & Symbol | Accession Number: 103334569 NCBI Gene Symbol: LOC103334569 |
Gene Aliases | |
Gene description & Other designations | Description: NADH dehydrogenase [ubiquinone] 1 alpha subcomplex subunit 9; mitochondrial Other designations: NADH dehydrogenase [ubiquinone] 1 alpha subcomplex subunit 9; mitochondrial |
Chromosome, Strand & Exon count | Chromosome: LG6 Strand: plus Exon count: 13 |
Gene Location within genomic sequence | Genomic accession No. NC_024131.1 Gene Start and end within genomic accession: 3292596 ...... 3296240 |
CDS Sequence | 103334569 |
| Marker Information | |
Marker Type | PMTM |
Repeat type & sequence | Repeat type: Hexa Repeat sequence: (TTCCAT)2 |
Repeat start & end within CDS | Repeat start: 977 Repeat end: 988 |
Forward primer | Primer sequence: CAAAGGCAATTGCAGCACCT Tm(°C): 59.966 GC (%): 50 Size: 20 |
Reverse primer | Primer sequence: AACCCTTCAGCTTATGGGGC Tm(°C): 60.033 GC (%): 55 Size: 20 |
Primer start, end within sequence and product size | Start: 934 End: 1107 Product size (bp): 174 |
JBrowse View | JBrowse |
|
| Gene Information | |
NCBI Gene Accession Number & Symbol | Accession Number: 103334569 NCBI Gene Symbol: LOC103334569 |
Gene Aliases | |
Gene description & Other designations | Description: NADH dehydrogenase [ubiquinone] 1 alpha subcomplex subunit 9; mitochondrial Other designations: NADH dehydrogenase [ubiquinone] 1 alpha subcomplex subunit 9; mitochondrial |
Chromosome, Strand & Exon count | Chromosome: LG6 Strand: plus Exon count: 13 |
Gene Location within genomic sequence | Genomic accession No. NC_024131.1 Gene Start and end within genomic accession: 3292596 ...... 3296240 |
CDS Sequence | 103334569 |
| Marker Information | |
Marker Type | PGTM |
Repeat type & sequence | Repeat type: Repeat sequence: |
Repeat start & end within CDS | Repeat start: Repeat end: |
Forward primer | Primer sequence: CAAAGGCAATTGCAGCACCT Tm(°C): 59.966 GC (%): 50 Size: 20 |
Reverse primer | Primer sequence: AACCCTTCAGCTTATGGGGC Tm(°C): 60.033 GC (%): 55 Size: 20 |
Primer start, end within sequence and product size | Start: 934 End: 1107 Product size (bp): 174 |
JBrowse View | JBrowse |