Statistics
Number of enzymes: 1
Total Number of designed primers: 2
Number of PGTM primers: 1
Number of PMTM primers: 1
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103330792 NCBI Gene Symbol: LOC103330792 |
| Gene Aliases | |
| Gene description & Other designations | Description: NADH dehydrogenase [ubiquinone] 1 alpha subcomplex subunit 6 Other designations: NADH dehydrogenase [ubiquinone] 1 alpha subcomplex subunit 6 |
| Chromosome, Strand & Exon count | Chromosome: LG5 Strand: minus Exon count: 2 |
| Gene Location within genomic sequence | Genomic accession No. NC_024130.1 Gene Start and end within genomic accession: 3457389 ...... 3459524 |
| CDS Sequence | 103330792 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Penta Repeat sequence: (CTCCG)2 |
| Repeat start & end within CDS | Repeat start: 157 Repeat end: 166 |
| Forward primer | Primer sequence: GTTTATTCAACGCGCCGTGA Tm(°C): 59.836 GC (%): 50 Size: 20 |
| Reverse primer | Primer sequence: CCCACCACATACTGGCCAAT Tm(°C): 60.033 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 5 End: 310 Product size (bp): 306 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103330792 NCBI Gene Symbol: LOC103330792 |
| Gene Aliases | |
| Gene description & Other designations | Description: NADH dehydrogenase [ubiquinone] 1 alpha subcomplex subunit 6 Other designations: NADH dehydrogenase [ubiquinone] 1 alpha subcomplex subunit 6 |
| Chromosome, Strand & Exon count | Chromosome: LG5 Strand: minus Exon count: 2 |
| Gene Location within genomic sequence | Genomic accession No. NC_024130.1 Gene Start and end within genomic accession: 3457389 ...... 3459524 |
| CDS Sequence | 103330792 |
| Marker Information | |
| Marker Type | PGTM |
| Repeat type & sequence | Repeat type: Repeat sequence: |
| Repeat start & end within CDS | Repeat start: Repeat end: |
| Forward primer | Primer sequence: GTTTATTCAACGCGCCGTGA Tm(°C): 59.836 GC (%): 50 Size: 20 |
| Reverse primer | Primer sequence: CCCACCACATACTGGCCAAT Tm(°C): 60.033 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 5 End: 310 Product size (bp): 306 |
| JBrowse View | JBrowse |
