|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103333706 NCBI Gene Symbol: LOC103333706 |
| Gene Aliases | |
| Gene description & Other designations | Description: probable NADH dehydrogenase [ubiquinone] 1 alpha subcomplex subunit 5; mitochondrial Other designations: probable NADH dehydrogenase [ubiquinone] 1 alpha subcomplex subunit 5; mitochondrial |
| Chromosome, Strand & Exon count | Chromosome: LG5 Strand: minus Exon count: 2 |
| Gene Location within genomic sequence | Genomic accession No. NC_024130.1 Gene Start and end within genomic accession: 25982232 ...... 25984016 |
| CDS Sequence | 103333706 |
| Marker Information | |
| Marker Type | PGTM |
| Repeat type & sequence | Repeat type: Repeat sequence: |
| Repeat start & end within CDS | Repeat start: Repeat end: |
| Forward primer | Primer sequence: TATGCCGCGAAGAAGAGGAC Tm(°C): 59.898 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: GCAGAGGGACATGTTTGGGA Tm(°C): 59.962 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 199 End: 396 Product size (bp): 198 |
| JBrowse View | JBrowse |
