|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103342624 NCBI Gene Symbol: LOC103342624 |
| Gene Aliases | |
| Gene description & Other designations | Description: NADH dehydrogenase [ubiquinone] 1 alpha subcomplex subunit 1 Other designations: LOW QUALITY PROTEIN: NADH dehydrogenase [ubiquinone] 1 alpha subcomplex subunit 1 |
| Chromosome, Strand & Exon count | Chromosome: LG1 Strand: minus Exon count: 3 |
| Gene Location within genomic sequence | Genomic accession No. NC_024126.1 Gene Start and end within genomic accession: 22538722 ...... 22540782 |
| CDS Sequence | 103342624 |
| Marker Information | |
| Marker Type | PGTM |
| Repeat type & sequence | Repeat type: Repeat sequence: |
| Repeat start & end within CDS | Repeat start: Repeat end: |
| Forward primer | Primer sequence: TGTCGCTGGTTTGGATGGAA Tm(°C): 59.89 GC (%): 50 Size: 20 |
| Reverse primer | Primer sequence: CATGGCTACGTCCCACATGT Tm(°C): 60.108 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 1 End: 140 Product size (bp): 140 |
| JBrowse View | JBrowse |
