Statistics
Number of enzymes: 1
Total Number of designed primers: 2
Number of PGTM primers: 1
Number of PMTM primers: 1
Number of Failed designed PMTM primers: 1
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103328064 NCBI Gene Symbol: LOC103328064 |
| Gene Aliases | |
| Gene description & Other designations | Description: NADH dehydrogenase [ubiquinone] flavoprotein 2; mitochondrial Other designations: NADH dehydrogenase [ubiquinone] flavoprotein 2; mitochondrial |
| Chromosome, Strand & Exon count | Chromosome: LG4 Strand: minus Exon count: 10 |
| Gene Location within genomic sequence | Genomic accession No. NC_024129.1 Gene Start and end within genomic accession: 5734728 ...... 5738771 |
| CDS Sequence | 103328064 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Tri Repeat sequence: (CAG)3 |
| Repeat start & end within CDS | Repeat start: 229 Repeat end: 237 |
| Forward primer | Primer sequence: TCGCTTCCAATCGTCTCCAC Tm(°C): 60.109 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: CCCACCTTCGTCCGATTGAA Tm(°C): 60.037 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 13 End: 355 Product size (bp): 343 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103328064 NCBI Gene Symbol: LOC103328064 |
| Gene Aliases | |
| Gene description & Other designations | Description: NADH dehydrogenase [ubiquinone] flavoprotein 2; mitochondrial Other designations: NADH dehydrogenase [ubiquinone] flavoprotein 2; mitochondrial |
| Chromosome, Strand & Exon count | Chromosome: LG4 Strand: minus Exon count: 10 |
| Gene Location within genomic sequence | Genomic accession No. NC_024129.1 Gene Start and end within genomic accession: 5734728 ...... 5738771 |
| CDS Sequence | 103328064 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Penta Repeat sequence: (CTCGC)2 |
| Repeat start & end within CDS | Repeat start: 8 Repeat end: 17 |
| Forward primer | Primer sequence: None Tm(°C): GC (%): Size: |
| Reverse primer | Primer sequence: None Tm(°C): GC (%): Size: |
| Primer start, end within sequence and product size | Start: End: Product size (bp): |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103328064 NCBI Gene Symbol: LOC103328064 |
| Gene Aliases | |
| Gene description & Other designations | Description: NADH dehydrogenase [ubiquinone] flavoprotein 2; mitochondrial Other designations: NADH dehydrogenase [ubiquinone] flavoprotein 2; mitochondrial |
| Chromosome, Strand & Exon count | Chromosome: LG4 Strand: minus Exon count: 10 |
| Gene Location within genomic sequence | Genomic accession No. NC_024129.1 Gene Start and end within genomic accession: 5734728 ...... 5738771 |
| CDS Sequence | 103328064 |
| Marker Information | |
| Marker Type | PGTM |
| Repeat type & sequence | Repeat type: Repeat sequence: |
| Repeat start & end within CDS | Repeat start: Repeat end: |
| Forward primer | Primer sequence: TTCAATCGGACGAAGGTGGG Tm(°C): 60.037 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: TCACACAGCTTCCCATGCAT Tm(°C): 59.961 GC (%): 50 Size: 20 |
| Primer start, end within sequence and product size | Start: 336 End: 516 Product size (bp): 181 |
| JBrowse View | JBrowse |
