Statistics
Number of enzymes: 1
Total Number of designed primers: 5
Number of PGTM primers: 1
Number of PMTM primers: 4
|
| Gene Information | |
NCBI Gene Accession Number & Symbol | Accession Number: 103321985 NCBI Gene Symbol: LOC103321985 |
Gene Aliases | |
Gene description & Other designations | Description: NADH dehydrogenase [ubiquinone] flavoprotein 1; mitochondrial Other designations: NADH dehydrogenase [ubiquinone] flavoprotein 1; mitochondrial |
Chromosome, Strand & Exon count | Chromosome: LG2 Strand: plus Exon count: 3 |
Gene Location within genomic sequence | Genomic accession No. NC_024127.1 Gene Start and end within genomic accession: 20051924 ...... 20055467 |
CDS Sequence | 103321985 |
| Marker Information | |
Marker Type | PMTM |
Repeat type & sequence | Repeat type: Compound Repeat sequence: (GATTG)2tc(AATGA)2agaagtctggcctccgtggac(GTG)3 |
Repeat start & end within CDS | Repeat start: 289 Repeat end: 340 |
Forward primer | Primer sequence: CCCACCTCCAGAGAAAACCC Tm(°C): 59.962 GC (%): 60 Size: 20 |
Reverse primer | Primer sequence: TGTGTGGATCATGGCGCATA Tm(°C): 59.82 GC (%): 50 Size: 20 |
Primer start, end within sequence and product size | Start: 140 End: 477 Product size (bp): 338 |
JBrowse View | JBrowse |
|
| Gene Information | |
NCBI Gene Accession Number & Symbol | Accession Number: 103321985 NCBI Gene Symbol: LOC103321985 |
Gene Aliases | |
Gene description & Other designations | Description: NADH dehydrogenase [ubiquinone] flavoprotein 1; mitochondrial Other designations: NADH dehydrogenase [ubiquinone] flavoprotein 1; mitochondrial |
Chromosome, Strand & Exon count | Chromosome: LG2 Strand: plus Exon count: 3 |
Gene Location within genomic sequence | Genomic accession No. NC_024127.1 Gene Start and end within genomic accession: 20051924 ...... 20055467 |
CDS Sequence | 103321985 |
| Marker Information | |
Marker Type | PMTM |
Repeat type & sequence | Repeat type: Hexa Repeat sequence: (TGGTGC)2 |
Repeat start & end within CDS | Repeat start: 666 Repeat end: 677 |
Forward primer | Primer sequence: ATGAAGCTGGGTTACTGGGC Tm(°C): 60.034 GC (%): 55 Size: 20 |
Reverse primer | Primer sequence: GAAACAGCCACCGTTTCCAC Tm(°C): 59.97 GC (%): 55 Size: 20 |
Primer start, end within sequence and product size | Start: 598 End: 820 Product size (bp): 223 |
JBrowse View | JBrowse |
|
| Gene Information | |
NCBI Gene Accession Number & Symbol | Accession Number: 103321985 NCBI Gene Symbol: LOC103321985 |
Gene Aliases | |
Gene description & Other designations | Description: NADH dehydrogenase [ubiquinone] flavoprotein 1; mitochondrial Other designations: NADH dehydrogenase [ubiquinone] flavoprotein 1; mitochondrial |
Chromosome, Strand & Exon count | Chromosome: LG2 Strand: plus Exon count: 3 |
Gene Location within genomic sequence | Genomic accession No. NC_024127.1 Gene Start and end within genomic accession: 20051924 ...... 20055467 |
CDS Sequence | 103321985 |
| Marker Information | |
Marker Type | PMTM |
Repeat type & sequence | Repeat type: Penta Repeat sequence: (AGGGA)2 |
Repeat start & end within CDS | Repeat start: 1225 Repeat end: 1234 |
Forward primer | Primer sequence: CTGAAGGCTGTCCAGTCAGG Tm(°C): 60.037 GC (%): 60 Size: 20 |
Reverse primer | Primer sequence: GCTCCCTGATCCTCCTCTCA Tm(°C): 60.106 GC (%): 60 Size: 20 |
Primer start, end within sequence and product size | Start: 1092 End: 1425 Product size (bp): 334 |
JBrowse View | JBrowse |
|
| Gene Information | |
NCBI Gene Accession Number & Symbol | Accession Number: 103321985 NCBI Gene Symbol: LOC103321985 |
Gene Aliases | |
Gene description & Other designations | Description: NADH dehydrogenase [ubiquinone] flavoprotein 1; mitochondrial Other designations: NADH dehydrogenase [ubiquinone] flavoprotein 1; mitochondrial |
Chromosome, Strand & Exon count | Chromosome: LG2 Strand: plus Exon count: 3 |
Gene Location within genomic sequence | Genomic accession No. NC_024127.1 Gene Start and end within genomic accession: 20051924 ...... 20055467 |
CDS Sequence | 103321985 |
| Marker Information | |
Marker Type | PMTM |
Repeat type & sequence | Repeat type: Compound Repeat sequence: (TGC)3(GCCTG)2* |
Repeat start & end within CDS | Repeat start: 1356 Repeat end: 1372 |
Forward primer | Primer sequence: CTGAAGGCTGTCCAGTCAGG Tm(°C): 60.037 GC (%): 60 Size: 20 |
Reverse primer | Primer sequence: GCTCCCTGATCCTCCTCTCA Tm(°C): 60.106 GC (%): 60 Size: 20 |
Primer start, end within sequence and product size | Start: 1092 End: 1425 Product size (bp): 334 |
JBrowse View | JBrowse |
|
| Gene Information | |
NCBI Gene Accession Number & Symbol | Accession Number: 103321985 NCBI Gene Symbol: LOC103321985 |
Gene Aliases | |
Gene description & Other designations | Description: NADH dehydrogenase [ubiquinone] flavoprotein 1; mitochondrial Other designations: NADH dehydrogenase [ubiquinone] flavoprotein 1; mitochondrial |
Chromosome, Strand & Exon count | Chromosome: LG2 Strand: plus Exon count: 3 |
Gene Location within genomic sequence | Genomic accession No. NC_024127.1 Gene Start and end within genomic accession: 20051924 ...... 20055467 |
CDS Sequence | 103321985 |
| Marker Information | |
Marker Type | PGTM |
Repeat type & sequence | Repeat type: Repeat sequence: |
Repeat start & end within CDS | Repeat start: Repeat end: |
Forward primer | Primer sequence: CCCATCTGGCCTCAAATGGT Tm(°C): 60.033 GC (%): 55 Size: 20 |
Reverse primer | Primer sequence: GAAACAGCCACCGTTTCCAC Tm(°C): 59.97 GC (%): 55 Size: 20 |
Primer start, end within sequence and product size | Start: 347 End: 820 Product size (bp): 474 |
JBrowse View | JBrowse |