Statistics
Number of enzymes: 1
Total Number of designed primers: 2
Number of PGTM primers: 1
Number of PMTM primers: 1
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103335651 NCBI Gene Symbol: LOC103335651 |
| Gene Aliases | |
| Gene description & Other designations | Description: NADH dehydrogenase [ubiquinone] iron-sulfur protein 8; mitochondrial Other designations: NADH dehydrogenase [ubiquinone] iron-sulfur protein 8; mitochondrial |
| Chromosome, Strand & Exon count | Chromosome: LG6 Strand: plus Exon count: 8 |
| Gene Location within genomic sequence | Genomic accession No. NC_024131.1 Gene Start and end within genomic accession: 11049657 ...... 11054181 |
| CDS Sequence | 103335651 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Compound Repeat sequence: (TGAGGC)2acgagaagatggtagccgtaggactactaggta(TGACAT)2(TGA
CA)2* |
| Repeat start & end within CDS | Repeat start: 420 Repeat end: 480 |
| Forward primer | Primer sequence: TCGTGGTGAACATGCCCTAC Tm(°C): 60.037 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: TGTCTCCATTCTCGAGCAGC Tm(°C): 59.826 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 320 End: 615 Product size (bp): 296 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103335651 NCBI Gene Symbol: LOC103335651 |
| Gene Aliases | |
| Gene description & Other designations | Description: NADH dehydrogenase [ubiquinone] iron-sulfur protein 8; mitochondrial Other designations: NADH dehydrogenase [ubiquinone] iron-sulfur protein 8; mitochondrial |
| Chromosome, Strand & Exon count | Chromosome: LG6 Strand: plus Exon count: 8 |
| Gene Location within genomic sequence | Genomic accession No. NC_024131.1 Gene Start and end within genomic accession: 11049657 ...... 11054181 |
| CDS Sequence | 103335651 |
| Marker Information | |
| Marker Type | PGTM |
| Repeat type & sequence | Repeat type: Repeat sequence: |
| Repeat start & end within CDS | Repeat start: Repeat end: |
| Forward primer | Primer sequence: GAGGTCTGATGCTGACGCTT Tm(°C): 60.108 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: GTAGGGCATGTTCACCACGA Tm(°C): 60.037 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 232 End: 339 Product size (bp): 108 |
| JBrowse View | JBrowse |
