Statistics
Number of enzymes: 1
Total Number of designed primers: 3
Number of PGTM primers: 1
Number of PMTM primers: 2
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103320537 NCBI Gene Symbol: LOC103320537 |
| Gene Aliases | |
| Gene description & Other designations | Description: NADH dehydrogenase [ubiquinone] iron-sulfur protein 7; mitochondrial Other designations: NADH dehydrogenase [ubiquinone] iron-sulfur protein 7; mitochondrial |
| Chromosome, Strand & Exon count | Chromosome: LG2 Strand: minus Exon count: 2 |
| Gene Location within genomic sequence | Genomic accession No. NC_024127.1 Gene Start and end within genomic accession: 11272897 ...... 11274599 |
| CDS Sequence | 103320537 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Compound Repeat sequence: (CT)4ccacacgaccgtcccctcgctgtcg(TCC)3 |
| Repeat start & end within CDS | Repeat start: 58 Repeat end: 99 |
| Forward primer | Primer sequence: ATCCCTCTCCAGCTCTCGG Tm(°C): 60.153 GC (%): 63.158 Size: 19 |
| Reverse primer | Primer sequence: GGCCCAGTTCATGAGATCGT Tm(°C): 59.821 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 27 End: 224 Product size (bp): 198 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103320537 NCBI Gene Symbol: LOC103320537 |
| Gene Aliases | |
| Gene description & Other designations | Description: NADH dehydrogenase [ubiquinone] iron-sulfur protein 7; mitochondrial Other designations: NADH dehydrogenase [ubiquinone] iron-sulfur protein 7; mitochondrial |
| Chromosome, Strand & Exon count | Chromosome: LG2 Strand: minus Exon count: 2 |
| Gene Location within genomic sequence | Genomic accession No. NC_024127.1 Gene Start and end within genomic accession: 11272897 ...... 11274599 |
| CDS Sequence | 103320537 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Compound Repeat sequence: (CTCCAG)2(AGA)3* |
| Repeat start & end within CDS | Repeat start: 586 Repeat end: 604 |
| Forward primer | Primer sequence: TCGGGGTTGTGACAGGATTG Tm(°C): 59.964 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: ACTTCGTCCACCAAAGGAGG Tm(°C): 59.603 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 503 End: 642 Product size (bp): 140 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103320537 NCBI Gene Symbol: LOC103320537 |
| Gene Aliases | |
| Gene description & Other designations | Description: NADH dehydrogenase [ubiquinone] iron-sulfur protein 7; mitochondrial Other designations: NADH dehydrogenase [ubiquinone] iron-sulfur protein 7; mitochondrial |
| Chromosome, Strand & Exon count | Chromosome: LG2 Strand: minus Exon count: 2 |
| Gene Location within genomic sequence | Genomic accession No. NC_024127.1 Gene Start and end within genomic accession: 11272897 ...... 11274599 |
| CDS Sequence | 103320537 |
| Marker Information | |
| Marker Type | PGTM |
| Repeat type & sequence | Repeat type: Repeat sequence: |
| Repeat start & end within CDS | Repeat start: Repeat end: |
| Forward primer | Primer sequence: TGGGTCCATCTGGCCTATGA Tm(°C): 60.03 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: CAATCCTGTCACAACCCCGA Tm(°C): 59.964 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 230 End: 522 Product size (bp): 293 |
| JBrowse View | JBrowse |
