Enzyme Id: K03939 |
||||||||||||||||||||||||||||||||||||||||||||||||
Gene Information | ||||||||||||||||||||||||||||||||||||||||||||||||
NCBI Gene Accession Number & Symbol | Accession Number: 103333499 NCBI Gene Symbol: LOC103333499 | |||||||||||||||||||||||||||||||||||||||||||||||
Gene Aliases | ||||||||||||||||||||||||||||||||||||||||||||||||
Gene description & Other designations | Description: NADH dehydrogenase [ubiquinone] iron-sulfur protein 6; mitochondrial Other designations: NADH dehydrogenase [ubiquinone] iron-sulfur protein 6; mitochondrial | |||||||||||||||||||||||||||||||||||||||||||||||
Chromosome, Strand & Exon count | Chromosome: LG5 Strand: minus Exon count: 3 | |||||||||||||||||||||||||||||||||||||||||||||||
Gene Location within genomic sequence | Genomic accession No. NC_024130.1 Gene Start and end within genomic accession: 24800841 ...... 24802672 | |||||||||||||||||||||||||||||||||||||||||||||||
CDS Sequence | 103333499 | |||||||||||||||||||||||||||||||||||||||||||||||
Marker Information | ||||||||||||||||||||||||||||||||||||||||||||||||
Marker Type | PMTM | |||||||||||||||||||||||||||||||||||||||||||||||
Repeat type & sequence | Repeat type: Tri Repeat sequence: (CAC)3 | |||||||||||||||||||||||||||||||||||||||||||||||
Repeat start & end within CDS | Repeat start: 304 Repeat end: 312 | |||||||||||||||||||||||||||||||||||||||||||||||
Forward primer | Primer sequence: None Tm(°C): GC (%): Size: | |||||||||||||||||||||||||||||||||||||||||||||||
Reverse primer | Primer sequence: None Tm(°C): GC (%): Size: | |||||||||||||||||||||||||||||||||||||||||||||||
Primer start, end within sequence and product size | Start: End: Product size (bp): | |||||||||||||||||||||||||||||||||||||||||||||||
JBrowse View | JBrowse |
Enzyme Id: K03939 |
||
Gene Information | ||
NCBI Gene Accession Number & Symbol | Accession Number: 103333499 NCBI Gene Symbol: LOC103333499 | |
Gene Aliases | ||
Gene description & Other designations | Description: NADH dehydrogenase [ubiquinone] iron-sulfur protein 6; mitochondrial Other designations: NADH dehydrogenase [ubiquinone] iron-sulfur protein 6; mitochondrial | |
Chromosome, Strand & Exon count | Chromosome: LG5 Strand: minus Exon count: 3 | |
Gene Location within genomic sequence | Genomic accession No. NC_024130.1 Gene Start and end within genomic accession: 24800841 ...... 24802672 | |
CDS Sequence | 103333499 | |
Marker Information | ||
Marker Type | PGTM | |
Repeat type & sequence | Repeat type: Repeat sequence: | |
Repeat start & end within CDS | Repeat start: Repeat end: | |
Forward primer | Primer sequence: CAGCCTCGTCAGGAGTCAAA Tm(°C): 59.682 GC (%): 55 Size: 20 | |
Reverse primer | Primer sequence: TGCCCAAGTGCAGGATCAAT Tm(°C): 59.96 GC (%): 50 Size: 20 | |
Primer start, end within sequence and product size | Start: 68 End: 223 Product size (bp): 156 | |
JBrowse View | JBrowse |