Enzyme Id: K03937 |
||||||||||||||||||||||||||||||||||||||||||||||||
| Gene Information | ||||||||||||||||||||||||||||||||||||||||||||||||
| NCBI Gene Accession Number & Symbol | Accession Number: 103336521 NCBI Gene Symbol: LOC103336521 | |||||||||||||||||||||||||||||||||||||||||||||||
| Gene Aliases | ||||||||||||||||||||||||||||||||||||||||||||||||
| Gene description & Other designations | Description: NADH dehydrogenase [ubiquinone] iron-sulfur protein 4; mitochondrial Other designations: NADH dehydrogenase [ubiquinone] iron-sulfur protein 4; mitochondrial | |||||||||||||||||||||||||||||||||||||||||||||||
| Chromosome, Strand & Exon count | Chromosome: LG1 Strand: minus Exon count: 5 | |||||||||||||||||||||||||||||||||||||||||||||||
| Gene Location within genomic sequence | Genomic accession No. NC_024126.1 Gene Start and end within genomic accession: 19048137 ...... 19051112 | |||||||||||||||||||||||||||||||||||||||||||||||
| CDS Sequence | 103336521 | |||||||||||||||||||||||||||||||||||||||||||||||
| Marker Information | ||||||||||||||||||||||||||||||||||||||||||||||||
| Marker Type | PGTM | |||||||||||||||||||||||||||||||||||||||||||||||
| Repeat type & sequence | Repeat type: Repeat sequence: | |||||||||||||||||||||||||||||||||||||||||||||||
| Repeat start & end within CDS | Repeat start: Repeat end: | |||||||||||||||||||||||||||||||||||||||||||||||
| Forward primer | Primer sequence: CATCTTCGCAGGAGGGTTGT Tm(°C): 60.036 GC (%): 55 Size: 20 | |||||||||||||||||||||||||||||||||||||||||||||||
| Reverse primer | Primer sequence: GCATACGGGTCACCAGTTGA Tm(°C): 60.037 GC (%): 55 Size: 20 | |||||||||||||||||||||||||||||||||||||||||||||||
| Primer start, end within sequence and product size | Start: 144 End: 295 Product size (bp): 152 | |||||||||||||||||||||||||||||||||||||||||||||||
| JBrowse View | JBrowse | |||||||||||||||||||||||||||||||||||||||||||||||
Enzyme Id: K03937 |
||
| Gene Information | ||
| NCBI Gene Accession Number & Symbol | Accession Number: 103320475 NCBI Gene Symbol: LOC103320475 | |
| Gene Aliases | ||
| Gene description & Other designations | Description: NADH dehydrogenase [ubiquinone] iron-sulfur protein 4; mitochondrial-like Other designations: NADH dehydrogenase [ubiquinone] iron-sulfur protein 4; mitochondrial-like | |
| Chromosome, Strand & Exon count | Chromosome: LG2 Strand: plus Exon count: 5 | |
| Gene Location within genomic sequence | Genomic accession No. NC_024127.1 Gene Start and end within genomic accession: 10887131 ...... 10889087 | |
| CDS Sequence | 103320475 | |
| Marker Information | ||
| Marker Type | PGTM | |
| Repeat type & sequence | Repeat type: Repeat sequence: | |
| Repeat start & end within CDS | Repeat start: Repeat end: | |
| Forward primer | Primer sequence: CGAACTGCAACCCAACAAGG Tm(°C): 59.969 GC (%): 55 Size: 20 | |
| Reverse primer | Primer sequence: CAGTCCTGCCTCACCAACAT Tm(°C): 59.963 GC (%): 55 Size: 20 | |
| Primer start, end within sequence and product size | Start: 177 End: 314 Product size (bp): 138 | |
| JBrowse View | JBrowse | |