image


Statistics

Number of enzymes: 1
Total Number of designed primers: 9
Number of PGTM primers:     2
Number of PMTM primers:     7

Enzyme Id:  K03934
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103342521     NCBI Gene Symbol: LOC103342521
Gene Aliases
Gene description & Other designations Description:   NADH dehydrogenase [ubiquinone] iron-sulfur protein 1; mitochondrial      Other designations:   NADH dehydrogenase [ubiquinone] iron-sulfur protein 1; mitochondrial
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 103342521
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (CCG)3
Repeat start & end within CDS Repeat start: 62     Repeat end: 70
Forward primer Primer sequence:   TTGGGATCGCTTGCTTCGAG     Tm(°C): 60.741     GC (%): 55     Size: 20
Reverse primer Primer sequence:   ACGAGACACATCCGGCAATT     Tm(°C): 60.036     GC (%): 50     Size: 20
Primer start, end within sequence and product size Start: 6     End: 277     Product size (bp): 272
JBrowse View      JBrowse

Enzyme Id:  K03934
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103342521     NCBI Gene Symbol: LOC103342521
Gene Aliases
Gene description & Other designations Description:   NADH dehydrogenase [ubiquinone] iron-sulfur protein 1; mitochondrial      Other designations:   NADH dehydrogenase [ubiquinone] iron-sulfur protein 1; mitochondrial
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 103342521
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (GTGTG)2
Repeat start & end within CDS Repeat start: 1135     Repeat end: 1144
Forward primer Primer sequence:   CCTTGCCGTAGTTGCTGAGA     Tm(°C): 60.037     GC (%): 55     Size: 20
Reverse primer Primer sequence:   GTGGGTAGCTTGCACTGTCT     Tm(°C): 59.965     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 1004     End: 1310     Product size (bp): 307
JBrowse View      JBrowse

Enzyme Id:  K03934
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103342521     NCBI Gene Symbol: LOC103342521
Gene Aliases
Gene description & Other designations Description:   NADH dehydrogenase [ubiquinone] iron-sulfur protein 1; mitochondrial      Other designations:   NADH dehydrogenase [ubiquinone] iron-sulfur protein 1; mitochondrial
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 103342521
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (GCA)3
Repeat start & end within CDS Repeat start: 1771     Repeat end: 1779
Forward primer Primer sequence:   GACCTTGGACTTGTGCCAGA     Tm(°C): 59.891     GC (%): 55     Size: 20
Reverse primer Primer sequence:   CCCTAGCATCACCGACAGTC     Tm(°C): 59.897     GC (%): 60     Size: 20
Primer start, end within sequence and product size Start: 1602     End: 1866     Product size (bp): 265
JBrowse View      JBrowse

Enzyme Id:  K03934
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103342521     NCBI Gene Symbol: LOC103342521
Gene Aliases
Gene description & Other designations Description:   NADH dehydrogenase [ubiquinone] iron-sulfur protein 1; mitochondrial      Other designations:   NADH dehydrogenase [ubiquinone] iron-sulfur protein 1; mitochondrial
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 103342521
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Compound     Repeat sequence: (GA)4gccagcta(CATTTT)2
Repeat start & end within CDS Repeat start: 1987     Repeat end: 2014
Forward primer Primer sequence:   TGTCATCCTTCCTGCAGCAG     Tm(°C): 60.036     GC (%): 55     Size: 20
Reverse primer Primer sequence:   TTCTCAACGGCAGTCCCAAA     Tm(°C): 59.818     GC (%): 50     Size: 20
Primer start, end within sequence and product size Start: 1757     End: 2074     Product size (bp): 318
JBrowse View      JBrowse

Enzyme Id:  K03934
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103342521     NCBI Gene Symbol: LOC103342521
Gene Aliases
Gene description & Other designations Description:   NADH dehydrogenase [ubiquinone] iron-sulfur protein 1; mitochondrial      Other designations:   NADH dehydrogenase [ubiquinone] iron-sulfur protein 1; mitochondrial
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 103342521
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   AGACAGTGCAAGCTACCCAC     Tm(°C): 59.965     GC (%): 55     Size: 20
Reverse primer Primer sequence:   AGAAAATGGGTGACGACGCT     Tm(°C): 59.965     GC (%): 50     Size: 20
Primer start, end within sequence and product size Start: 1291     End: 1421     Product size (bp): 131
JBrowse View      JBrowse

Enzyme Id:  K03934
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103328719     NCBI Gene Symbol: LOC103328719
Gene Aliases
Gene description & Other designations Description:   NADH dehydrogenase [ubiquinone] iron-sulfur protein 1; mitochondrial      Other designations:   NADH dehydrogenase [ubiquinone] iron-sulfur protein 1; mitochondrial
Chromosome, Strand & Exon count Chromosome:   LG4     Strand:   plus     Exon count:   4
Gene Location within genomic sequence Genomic accession No. NC_024129.1      Gene Start and end within genomic accession: 13393189 ...... 13398447
CDS Sequence 103328719
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (GTGTG)2
Repeat start & end within CDS Repeat start: 799     Repeat end: 808
Forward primer Primer sequence:   CCTTGCCGTAGTTGCTGAGA     Tm(°C): 60.037     GC (%): 55     Size: 20
Reverse primer Primer sequence:   GTGGGTAGCTTGCACTGTCT     Tm(°C): 59.965     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 668     End: 974     Product size (bp): 307
JBrowse View      JBrowse

Enzyme Id:  K03934
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103328719     NCBI Gene Symbol: LOC103328719
Gene Aliases
Gene description & Other designations Description:   NADH dehydrogenase [ubiquinone] iron-sulfur protein 1; mitochondrial      Other designations:   NADH dehydrogenase [ubiquinone] iron-sulfur protein 1; mitochondrial
Chromosome, Strand & Exon count Chromosome:   LG4     Strand:   plus     Exon count:   4
Gene Location within genomic sequence Genomic accession No. NC_024129.1      Gene Start and end within genomic accession: 13393189 ...... 13398447
CDS Sequence 103328719
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (GCA)3
Repeat start & end within CDS Repeat start: 1435     Repeat end: 1443
Forward primer Primer sequence:   GACCTTGGACTTGTGCCAGA     Tm(°C): 59.891     GC (%): 55     Size: 20
Reverse primer Primer sequence:   CCCTAGCATCACCGACAGTC     Tm(°C): 59.897     GC (%): 60     Size: 20
Primer start, end within sequence and product size Start: 1266     End: 1530     Product size (bp): 265
JBrowse View      JBrowse

Enzyme Id:  K03934
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103328719     NCBI Gene Symbol: LOC103328719
Gene Aliases
Gene description & Other designations Description:   NADH dehydrogenase [ubiquinone] iron-sulfur protein 1; mitochondrial      Other designations:   NADH dehydrogenase [ubiquinone] iron-sulfur protein 1; mitochondrial
Chromosome, Strand & Exon count Chromosome:   LG4     Strand:   plus     Exon count:   4
Gene Location within genomic sequence Genomic accession No. NC_024129.1      Gene Start and end within genomic accession: 13393189 ...... 13398447
CDS Sequence 103328719
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Compound     Repeat sequence: (GA)4gccagcta(CATTTT)2
Repeat start & end within CDS Repeat start: 1651     Repeat end: 1678
Forward primer Primer sequence:   TGTCATCCTTCCTGCAGCAG     Tm(°C): 60.036     GC (%): 55     Size: 20
Reverse primer Primer sequence:   TTCTCAACGGCAGTCCCAAA     Tm(°C): 59.818     GC (%): 50     Size: 20
Primer start, end within sequence and product size Start: 1421     End: 1738     Product size (bp): 318
JBrowse View      JBrowse

Enzyme Id:  K03934
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103328719     NCBI Gene Symbol: LOC103328719
Gene Aliases
Gene description & Other designations Description:   NADH dehydrogenase [ubiquinone] iron-sulfur protein 1; mitochondrial      Other designations:   NADH dehydrogenase [ubiquinone] iron-sulfur protein 1; mitochondrial
Chromosome, Strand & Exon count Chromosome:   LG4     Strand:   plus     Exon count:   4
Gene Location within genomic sequence Genomic accession No. NC_024129.1      Gene Start and end within genomic accession: 13393189 ...... 13398447
CDS Sequence 103328719
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   TGTCATCCTTCCTGCAGCAG     Tm(°C): 60.036     GC (%): 55     Size: 20
Reverse primer Primer sequence:   TGTAGCTGGCTCTCTCTCGT     Tm(°C): 60.035     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 1421     End: 1667     Product size (bp): 247
JBrowse View      JBrowse