|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103320048 NCBI Gene Symbol: LOC103320048 |
| Gene Aliases | |
| Gene description & Other designations | Description: V-type proton ATPase subunit c''1 Other designations: V-type proton ATPase subunit c''1|V-type proton ATPase subunit c'' |
| Chromosome, Strand & Exon count | Chromosome: LG2 Strand: plus Exon count: 4 |
| Gene Location within genomic sequence | Genomic accession No. NC_024127.1 Gene Start and end within genomic accession: 8673721 ...... 8675769 |
| CDS Sequence | 103320048 |
| Marker Information | |
| Marker Type | PGTM |
| Repeat type & sequence | Repeat type: Repeat sequence: |
| Repeat start & end within CDS | Repeat start: Repeat end: |
| Forward primer | Primer sequence: AGGCCCCTCGTATCACTTCT Tm(°C): 60.032 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: CCCACGATAATCCCAGAGGC Tm(°C): 59.965 GC (%): 60 Size: 20 |
| Primer start, end within sequence and product size | Start: 172 End: 355 Product size (bp): 184 |
| JBrowse View | JBrowse |
