Statistics
Number of enzymes: 1
Total Number of designed primers: 7
Number of PGTM primers: 2
Number of PMTM primers: 5
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 111470927 NCBI Gene Symbol: LOC111470927 |
| Gene Aliases | |
| Gene description & Other designations | Description: 4-hydroxy-3-methylbut-2-enyl diphosphate reductase; chloroplastic Other designations: 4-hydroxy-3-methylbut-2-enyl diphosphate reductase; chloroplastic |
| Chromosome, Strand & Exon count | Chromosome: Un Strand: Exon count: |
| Gene Location within genomic sequence | Genomic accession No. Gene Start and end within genomic accession: ...... |
| CDS Sequence | 111470927 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Compound Repeat sequence: (CTTCTG)2(CTT)4 |
| Repeat start & end within CDS | Repeat start: 125 Repeat end: 148 |
| Forward primer | Primer sequence: GAGAGTTTCCCCGGAGTTCG Tm(°C): 60.109 GC (%): 60 Size: 20 |
| Reverse primer | Primer sequence: CATAAGCGCCAGAGTCTCGT Tm(°C): 59.899 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 57 End: 266 Product size (bp): 210 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 111470927 NCBI Gene Symbol: LOC111470927 |
| Gene Aliases | |
| Gene description & Other designations | Description: 4-hydroxy-3-methylbut-2-enyl diphosphate reductase; chloroplastic Other designations: 4-hydroxy-3-methylbut-2-enyl diphosphate reductase; chloroplastic |
| Chromosome, Strand & Exon count | Chromosome: Un Strand: Exon count: |
| Gene Location within genomic sequence | Genomic accession No. Gene Start and end within genomic accession: ...... |
| CDS Sequence | 111470927 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Di Repeat sequence: (TG)4 |
| Repeat start & end within CDS | Repeat start: 801 Repeat end: 808 |
| Forward primer | Primer sequence: AGAACATGGCAGAGGCAACA Tm(°C): 59.889 GC (%): 50 Size: 20 |
| Reverse primer | Primer sequence: TTTTCGACTCCATGCTTGCG Tm(°C): 59.483 GC (%): 50 Size: 20 |
| Primer start, end within sequence and product size | Start: 778 End: 1018 Product size (bp): 241 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 111470927 NCBI Gene Symbol: LOC111470927 |
| Gene Aliases | |
| Gene description & Other designations | Description: 4-hydroxy-3-methylbut-2-enyl diphosphate reductase; chloroplastic Other designations: 4-hydroxy-3-methylbut-2-enyl diphosphate reductase; chloroplastic |
| Chromosome, Strand & Exon count | Chromosome: Un Strand: Exon count: |
| Gene Location within genomic sequence | Genomic accession No. Gene Start and end within genomic accession: ...... |
| CDS Sequence | 111470927 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Penta Repeat sequence: (AACCA)2 |
| Repeat start & end within CDS | Repeat start: 934 Repeat end: 943 |
| Forward primer | Primer sequence: AGAACATGGCAGAGGCAACA Tm(°C): 59.889 GC (%): 50 Size: 20 |
| Reverse primer | Primer sequence: TTTTCGACTCCATGCTTGCG Tm(°C): 59.483 GC (%): 50 Size: 20 |
| Primer start, end within sequence and product size | Start: 778 End: 1018 Product size (bp): 241 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 111470927 NCBI Gene Symbol: LOC111470927 |
| Gene Aliases | |
| Gene description & Other designations | Description: 4-hydroxy-3-methylbut-2-enyl diphosphate reductase; chloroplastic Other designations: 4-hydroxy-3-methylbut-2-enyl diphosphate reductase; chloroplastic |
| Chromosome, Strand & Exon count | Chromosome: Un Strand: Exon count: |
| Gene Location within genomic sequence | Genomic accession No. Gene Start and end within genomic accession: ...... |
| CDS Sequence | 111470927 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Penta Repeat sequence: (CAATA)2 |
| Repeat start & end within CDS | Repeat start: 1044 Repeat end: 1053 |
| Forward primer | Primer sequence: CGCAAGCATGGAGTCGAAAA Tm(°C): 59.483 GC (%): 50 Size: 20 |
| Reverse primer | Primer sequence: TCCTGGGCCTATTCTCTGCT Tm(°C): 60.031 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 999 End: 1229 Product size (bp): 231 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 111470927 NCBI Gene Symbol: LOC111470927 |
| Gene Aliases | |
| Gene description & Other designations | Description: 4-hydroxy-3-methylbut-2-enyl diphosphate reductase; chloroplastic Other designations: 4-hydroxy-3-methylbut-2-enyl diphosphate reductase; chloroplastic |
| Chromosome, Strand & Exon count | Chromosome: Un Strand: Exon count: |
| Gene Location within genomic sequence | Genomic accession No. Gene Start and end within genomic accession: ...... |
| CDS Sequence | 111470927 |
| Marker Information | |
| Marker Type | PGTM |
| Repeat type & sequence | Repeat type: Repeat sequence: |
| Repeat start & end within CDS | Repeat start: Repeat end: |
| Forward primer | Primer sequence: TTCTTCTTCGTCGTCGGTGG Tm(°C): 60.04 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: ACCCTTGCCAACCACTTCAA Tm(°C): 60.033 GC (%): 50 Size: 20 |
| Primer start, end within sequence and product size | Start: 140 End: 554 Product size (bp): 415 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 111484238 NCBI Gene Symbol: LOC111484238 |
| Gene Aliases | |
| Gene description & Other designations | Description: 4-hydroxy-3-methylbut-2-enyl diphosphate reductase; chloroplastic-like Other designations: 4-hydroxy-3-methylbut-2-enyl diphosphate reductase; chloroplastic-like |
| Chromosome, Strand & Exon count | Chromosome: Un Strand: Exon count: |
| Gene Location within genomic sequence | Genomic accession No. Gene Start and end within genomic accession: ...... |
| CDS Sequence | 111484238 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Tri Repeat sequence: (CGG)3 |
| Repeat start & end within CDS | Repeat start: 69 Repeat end: 77 |
| Forward primer | Primer sequence: ATTTCTCTGCAGATCCCCCG Tm(°C): 59.528 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: CTGTGCACCGAACCAAAAGG Tm(°C): 59.969 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 6 End: 117 Product size (bp): 112 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 111484238 NCBI Gene Symbol: LOC111484238 |
| Gene Aliases | |
| Gene description & Other designations | Description: 4-hydroxy-3-methylbut-2-enyl diphosphate reductase; chloroplastic-like Other designations: 4-hydroxy-3-methylbut-2-enyl diphosphate reductase; chloroplastic-like |
| Chromosome, Strand & Exon count | Chromosome: Un Strand: Exon count: |
| Gene Location within genomic sequence | Genomic accession No. Gene Start and end within genomic accession: ...... |
| CDS Sequence | 111484238 |
| Marker Information | |
| Marker Type | PGTM |
| Repeat type & sequence | Repeat type: Repeat sequence: |
| Repeat start & end within CDS | Repeat start: Repeat end: |
| Forward primer | Primer sequence: CGAGGAATCCCGTCGTACTG Tm(°C): 59.971 GC (%): 60 Size: 20 |
| Reverse primer | Primer sequence: GCCCATCAGGTAGCCAGTTT Tm(°C): 60.034 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 1149 End: 1266 Product size (bp): 118 |
| JBrowse View | JBrowse |
