image


Statistics

Number of enzymes: 1
Total Number of designed primers: 16
Number of PGTM primers:     2
Number of PMTM primers:     14

Enzyme Id:  K03526
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   111469429     NCBI Gene Symbol: LOC111469429
Gene Aliases
Gene description & Other designations Description:   4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (ferredoxin); chloroplastic      Other designations:   4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (ferredoxin); chloroplastic
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 111469429
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (GAT)3
Repeat start & end within CDS Repeat start: 616     Repeat end: 624
Forward primer Primer sequence:   ATTTTGCTGATAGGCGGGCT     Tm(°C): 60.107     GC (%): 50     Size: 20
Reverse primer Primer sequence:   TGTTCCAATGCGCATTGCTC     Tm(°C): 60.109     GC (%): 50     Size: 20
Primer start, end within sequence and product size Start: 571     End: 713     Product size (bp): 143
JBrowse View      JBrowse

Enzyme Id:  K03526
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   111469429     NCBI Gene Symbol: LOC111469429
Gene Aliases
Gene description & Other designations Description:   4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (ferredoxin); chloroplastic      Other designations:   4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (ferredoxin); chloroplastic
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 111469429
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Hexa     Repeat sequence: (CATTGG)2
Repeat start & end within CDS Repeat start: 981     Repeat end: 992
Forward primer Primer sequence:   TGCCGAAAGTTGGACTTCCA     Tm(°C): 59.818     GC (%): 50     Size: 20
Reverse primer Primer sequence:   CATTCCAAGGTTTGCCAGCC     Tm(°C): 60.037     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 804     End: 1094     Product size (bp): 291
JBrowse View      JBrowse

Enzyme Id:  K03526
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   111469429     NCBI Gene Symbol: LOC111469429
Gene Aliases
Gene description & Other designations Description:   4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (ferredoxin); chloroplastic      Other designations:   4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (ferredoxin); chloroplastic
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 111469429
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (GGA)3
Repeat start & end within CDS Repeat start: 1050     Repeat end: 1058
Forward primer Primer sequence:   TGCCGAAAGTTGGACTTCCA     Tm(°C): 59.818     GC (%): 50     Size: 20
Reverse primer Primer sequence:   CATTCCAAGGTTTGCCAGCC     Tm(°C): 60.037     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 804     End: 1094     Product size (bp): 291
JBrowse View      JBrowse

Enzyme Id:  K03526
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   111469429     NCBI Gene Symbol: LOC111469429
Gene Aliases
Gene description & Other designations Description:   4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (ferredoxin); chloroplastic      Other designations:   4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (ferredoxin); chloroplastic
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 111469429
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (GTTCT)2
Repeat start & end within CDS Repeat start: 1238     Repeat end: 1247
Forward primer Primer sequence:   GGCTGGCAAACCTTGGAATG     Tm(°C): 60.037     GC (%): 55     Size: 20
Reverse primer Primer sequence:   ACAACAAGCTTCGCTGCAAG     Tm(°C): 59.97     GC (%): 50     Size: 20
Primer start, end within sequence and product size Start: 1075     End: 1318     Product size (bp): 244
JBrowse View      JBrowse

Enzyme Id:  K03526
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   111469429     NCBI Gene Symbol: LOC111469429
Gene Aliases
Gene description & Other designations Description:   4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (ferredoxin); chloroplastic      Other designations:   4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (ferredoxin); chloroplastic
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 111469429
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (TTG)3
Repeat start & end within CDS Repeat start: 1313     Repeat end: 1321
Forward primer Primer sequence:   CCGTGACGGTTCTGTTCTCA     Tm(°C): 59.968     GC (%): 55     Size: 20
Reverse primer Primer sequence:   GAGAGTGACCAGAGCCATGG     Tm(°C): 59.822     GC (%): 60     Size: 20
Primer start, end within sequence and product size Start: 1229     End: 1502     Product size (bp): 274
JBrowse View      JBrowse

Enzyme Id:  K03526
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   111469429     NCBI Gene Symbol: LOC111469429
Gene Aliases
Gene description & Other designations Description:   4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (ferredoxin); chloroplastic      Other designations:   4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (ferredoxin); chloroplastic
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 111469429
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Hexa     Repeat sequence: (TGATGC)2
Repeat start & end within CDS Repeat start: 1386     Repeat end: 1397
Forward primer Primer sequence:   CCGTGACGGTTCTGTTCTCA     Tm(°C): 59.968     GC (%): 55     Size: 20
Reverse primer Primer sequence:   GAGAGTGACCAGAGCCATGG     Tm(°C): 59.822     GC (%): 60     Size: 20
Primer start, end within sequence and product size Start: 1229     End: 1502     Product size (bp): 274
JBrowse View      JBrowse

Enzyme Id:  K03526
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   111469429     NCBI Gene Symbol: LOC111469429
Gene Aliases
Gene description & Other designations Description:   4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (ferredoxin); chloroplastic      Other designations:   4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (ferredoxin); chloroplastic
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 111469429
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (ACATC)2
Repeat start & end within CDS Repeat start: 1996     Repeat end: 2005
Forward primer Primer sequence:   GTGTCCTACTAGAGGCCCCA     Tm(°C): 60.032     GC (%): 60     Size: 20
Reverse primer Primer sequence:   AGATCGATCTTTCCGGGGGA     Tm(°C): 60.106     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 1825     End: 2110     Product size (bp): 286
JBrowse View      JBrowse

Enzyme Id:  K03526
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   111469429     NCBI Gene Symbol: LOC111469429
Gene Aliases
Gene description & Other designations Description:   4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (ferredoxin); chloroplastic      Other designations:   4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (ferredoxin); chloroplastic
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 111469429
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   CCGTGACGGTTCTGTTCTCA     Tm(°C): 59.968     GC (%): 55     Size: 20
Reverse primer Primer sequence:   TCACCGGAAAACTGAGACCG     Tm(°C): 59.967     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 1229     End: 1725     Product size (bp): 497
JBrowse View      JBrowse

Enzyme Id:  K03526
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   111493449     NCBI Gene Symbol: LOC111493449
Gene Aliases
Gene description & Other designations Description:   4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (ferredoxin); chloroplastic-like      Other designations:   4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (ferredoxin); chloroplastic-like
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 111493449
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (AAACA)2
Repeat start & end within CDS Repeat start: 240     Repeat end: 249
Forward primer Primer sequence:   GATTCGCGAATCGGTTGCAA     Tm(°C): 59.904     GC (%): 50     Size: 20
Reverse primer Primer sequence:   GATTGGCTCCCTTGTCAGCT     Tm(°C): 60.035     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 64     End: 399     Product size (bp): 336
JBrowse View      JBrowse

Enzyme Id:  K03526
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   111493449     NCBI Gene Symbol: LOC111493449
Gene Aliases
Gene description & Other designations Description:   4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (ferredoxin); chloroplastic-like      Other designations:   4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (ferredoxin); chloroplastic-like
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 111493449
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (CATTG)2
Repeat start & end within CDS Repeat start: 519     Repeat end: 528
Forward primer Primer sequence:   GCTGACAAGGGAGCCAATCT     Tm(°C): 60.035     GC (%): 55     Size: 20
Reverse primer Primer sequence:   AGCCCGCCTATCAGCAAAAT     Tm(°C): 60.107     GC (%): 50     Size: 20
Primer start, end within sequence and product size Start: 381     End: 590     Product size (bp): 210
JBrowse View      JBrowse

Enzyme Id:  K03526
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   111493449     NCBI Gene Symbol: LOC111493449
Gene Aliases
Gene description & Other designations Description:   4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (ferredoxin); chloroplastic-like      Other designations:   4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (ferredoxin); chloroplastic-like
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 111493449
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Hexa     Repeat sequence: (CATTGG)2
Repeat start & end within CDS Repeat start: 981     Repeat end: 992
Forward primer Primer sequence:   CTGAAGCCGGAGAAGGTGAG     Tm(°C): 60.108     GC (%): 60     Size: 20
Reverse primer Primer sequence:   AGAACAGAGCCATCACGGTG     Tm(°C): 60.037     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 940     End: 1246     Product size (bp): 307
JBrowse View      JBrowse

Enzyme Id:  K03526
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   111493449     NCBI Gene Symbol: LOC111493449
Gene Aliases
Gene description & Other designations Description:   4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (ferredoxin); chloroplastic-like      Other designations:   4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (ferredoxin); chloroplastic-like
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 111493449
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (GAG)3
Repeat start & end within CDS Repeat start: 1051     Repeat end: 1059
Forward primer Primer sequence:   GGCATTGGGACCCTTCTTCA     Tm(°C): 59.96     GC (%): 55     Size: 20
Reverse primer Primer sequence:   AGAACAGAGCCATCACGGTG     Tm(°C): 60.037     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 984     End: 1246     Product size (bp): 263
JBrowse View      JBrowse

Enzyme Id:  K03526
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   111493449     NCBI Gene Symbol: LOC111493449
Gene Aliases
Gene description & Other designations Description:   4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (ferredoxin); chloroplastic-like      Other designations:   4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (ferredoxin); chloroplastic-like
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 111493449
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (TTG)3
Repeat start & end within CDS Repeat start: 1313     Repeat end: 1321
Forward primer Primer sequence:   CACCGTGATGGCTCTGTTCT     Tm(°C): 60.037     GC (%): 55     Size: 20
Reverse primer Primer sequence:   GACTGACCAGAACCATGGCA     Tm(°C): 59.963     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 1227     End: 1500     Product size (bp): 274
JBrowse View      JBrowse

Enzyme Id:  K03526
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   111493449     NCBI Gene Symbol: LOC111493449
Gene Aliases
Gene description & Other designations Description:   4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (ferredoxin); chloroplastic-like      Other designations:   4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (ferredoxin); chloroplastic-like
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 111493449
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Hexa     Repeat sequence: (GATTTC)2
Repeat start & end within CDS Repeat start: 1852     Repeat end: 1863
Forward primer Primer sequence:   GGTGTCCTGTTAGAAGCCCC     Tm(°C): 60.035     GC (%): 60     Size: 20
Reverse primer Primer sequence:   ATTAGAGCCTCCGTCGCATG     Tm(°C): 59.967     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 1824     End: 2173     Product size (bp): 350
JBrowse View      JBrowse

Enzyme Id:  K03526
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   111493449     NCBI Gene Symbol: LOC111493449
Gene Aliases
Gene description & Other designations Description:   4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (ferredoxin); chloroplastic-like      Other designations:   4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (ferredoxin); chloroplastic-like
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 111493449
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Compound     Repeat sequence: (CATCT)2tcctggagtttctattgcaattatggg(TTGTA)2
Repeat start & end within CDS Repeat start: 1997     Repeat end: 2043
Forward primer Primer sequence:   GGTGTCCTGTTAGAAGCCCC     Tm(°C): 60.035     GC (%): 60     Size: 20
Reverse primer Primer sequence:   ATTAGAGCCTCCGTCGCATG     Tm(°C): 59.967     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 1824     End: 2173     Product size (bp): 350
JBrowse View      JBrowse

Enzyme Id:  K03526
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   111493449     NCBI Gene Symbol: LOC111493449
Gene Aliases
Gene description & Other designations Description:   4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (ferredoxin); chloroplastic-like      Other designations:   4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (ferredoxin); chloroplastic-like
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 111493449
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   GGTGTCCTGTTAGAAGCCCC     Tm(°C): 60.035     GC (%): 60     Size: 20
Reverse primer Primer sequence:   ATTAGAGCCTCCGTCGCATG     Tm(°C): 59.967     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 1824     End: 2173     Product size (bp): 350
JBrowse View      JBrowse