Statistics
Number of enzymes: 1
Total Number of designed primers: 3
Number of PGTM primers: 1
Number of PMTM primers: 2
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: PHAVU_003G178400g NCBI Gene Symbol: PHAVU_003G178400g |
| Gene Aliases | PHAVU_003G178400g |
| Gene description & Other designations | Description: hypothetical protein Other designations: hypothetical protein |
| Chromosome, Strand & Exon count | Chromosome: 3 Strand: minus Exon count: 4 |
| Gene Location within genomic sequence | Genomic accession No. NC_023757.1 Gene Start and end within genomic accession: 39035844 ...... 39038362 |
| CDS Sequence | PHAVU_003G178400g |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Hexa Repeat sequence: (CACCCG)2 |
| Repeat start & end within CDS | Repeat start: 164 Repeat end: 175 |
| Forward primer | Primer sequence: GCGTATCACCACCTTCCACA Tm(°C): 60.037 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: GCCTCCGATTGTTGCGAATC Tm(°C): 59.972 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 63 End: 360 Product size (bp): 298 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: PHAVU_003G178400g NCBI Gene Symbol: PHAVU_003G178400g |
| Gene Aliases | PHAVU_003G178400g |
| Gene description & Other designations | Description: hypothetical protein Other designations: hypothetical protein |
| Chromosome, Strand & Exon count | Chromosome: 3 Strand: minus Exon count: 4 |
| Gene Location within genomic sequence | Genomic accession No. NC_023757.1 Gene Start and end within genomic accession: 39035844 ...... 39038362 |
| CDS Sequence | PHAVU_003G178400g |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Hexa Repeat sequence: (CGAGAA)2 |
| Repeat start & end within CDS | Repeat start: 366 Repeat end: 377 |
| Forward primer | Primer sequence: GATTCGCAACAATCGGAGGC Tm(°C): 59.972 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: CTTTGGTCTCGAGGTTCCCC Tm(°C): 60.036 GC (%): 60 Size: 20 |
| Primer start, end within sequence and product size | Start: 341 End: 513 Product size (bp): 173 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: PHAVU_003G178400g NCBI Gene Symbol: PHAVU_003G178400g |
| Gene Aliases | PHAVU_003G178400g |
| Gene description & Other designations | Description: hypothetical protein Other designations: hypothetical protein |
| Chromosome, Strand & Exon count | Chromosome: 3 Strand: minus Exon count: 4 |
| Gene Location within genomic sequence | Genomic accession No. NC_023757.1 Gene Start and end within genomic accession: 39035844 ...... 39038362 |
| CDS Sequence | PHAVU_003G178400g |
| Marker Information | |
| Marker Type | PGTM |
| Repeat type & sequence | Repeat type: Repeat sequence: |
| Repeat start & end within CDS | Repeat start: Repeat end: |
| Forward primer | Primer sequence: GATTCGCAACAATCGGAGGC Tm(°C): 59.972 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: CTTTGGTCTCGAGGTTCCCC Tm(°C): 60.036 GC (%): 60 Size: 20 |
| Primer start, end within sequence and product size | Start: 341 End: 513 Product size (bp): 173 |
| JBrowse View | JBrowse |
