image


Statistics

Number of enzymes: 1
Total Number of designed primers: 7
Number of PGTM primers:     3
Number of PMTM primers:     4
Number of Failed designed PMTM primers: 1

Enzyme Id:  K02267

Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103328885     NCBI Gene Symbol: LOC103328885
Gene Aliases
Gene description & Other designations Description:   cytochrome c oxidase subunit 6b-3-like      Other designations:   cytochrome c oxidase subunit 6b-3-like
Chromosome, Strand & Exon count Chromosome:   LG4     Strand:   minus     Exon count:   4
Gene Location within genomic sequence Genomic accession No. NC_024129.1      Gene Start and end within genomic accession: 14925539 ...... 14927262
CDS Sequence 103328885
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (AGG)3
Repeat start & end within CDS Repeat start: 230     Repeat end: 238
Forward primer Primer sequence:   AAACCTAAGGACCCTGCTGC     Tm(°C): 59.962     GC (%): 55     Size: 20
Reverse primer Primer sequence:   AATTGGGCCAGCAAACACTC     Tm(°C): 59.319     GC (%): 50     Size: 20
Primer start, end within sequence and product size Start: 132     End: 350     Product size (bp): 219
JBrowse View      JBrowse

Enzyme Id:  K02267

Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103328885     NCBI Gene Symbol: LOC103328885
Gene Aliases
Gene description & Other designations Description:   cytochrome c oxidase subunit 6b-3-like      Other designations:   cytochrome c oxidase subunit 6b-3-like
Chromosome, Strand & Exon count Chromosome:   LG4     Strand:   minus     Exon count:   4
Gene Location within genomic sequence Genomic accession No. NC_024129.1      Gene Start and end within genomic accession: 14925539 ...... 14927262
CDS Sequence 103328885
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   AAACCTAAGGACCCTGCTGC     Tm(°C): 59.962     GC (%): 55     Size: 20
Reverse primer Primer sequence:   TAGGTACCTTGCCCTCCTCC     Tm(°C): 60.031     GC (%): 60     Size: 20
Primer start, end within sequence and product size Start: 132     End: 249     Product size (bp): 118
JBrowse View      JBrowse

Enzyme Id:  K02267

Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103319564     NCBI Gene Symbol: LOC103319564
Gene Aliases
Gene description & Other designations Description:   cytochrome c oxidase subunit 6b-1      Other designations:   cytochrome c oxidase subunit 6b-1
Chromosome, Strand & Exon count Chromosome:   LG2     Strand:   plus     Exon count:   5
Gene Location within genomic sequence Genomic accession No. NC_024127.1      Gene Start and end within genomic accession: 5212332 ...... 5215745
CDS Sequence 103319564
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (CTG)3
Repeat start & end within CDS Repeat start: 146     Repeat end: 154
Forward primer Primer sequence:   CCCAAACCCTAGCTGAGCAA     Tm(°C): 59.962     GC (%): 55     Size: 20
Reverse primer Primer sequence:   TTCGCCAGCTGGTGTAACTT     Tm(°C): 59.892     GC (%): 50     Size: 20
Primer start, end within sequence and product size Start: 25     End: 188     Product size (bp): 164
JBrowse View      JBrowse

Enzyme Id:  K02267

Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103319564     NCBI Gene Symbol: LOC103319564
Gene Aliases
Gene description & Other designations Description:   cytochrome c oxidase subunit 6b-1      Other designations:   cytochrome c oxidase subunit 6b-1
Chromosome, Strand & Exon count Chromosome:   LG2     Strand:   plus     Exon count:   5
Gene Location within genomic sequence Genomic accession No. NC_024127.1      Gene Start and end within genomic accession: 5212332 ...... 5215745
CDS Sequence 103319564
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Compound     Repeat sequence: (CTG)4gcatagaagctactgaaaccaatcctgccactgaa(GCT)3
Repeat start & end within CDS Repeat start: 209     Repeat end: 264
Forward primer Primer sequence:   AAGTTACACCAGCTGGCGAA     Tm(°C): 59.892     GC (%): 50     Size: 20
Reverse primer Primer sequence:   TTGTCACACTCTGGAGCACC     Tm(°C): 59.893     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 169     End: 457     Product size (bp): 289
JBrowse View      JBrowse

Enzyme Id:  K02267

Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103319564     NCBI Gene Symbol: LOC103319564
Gene Aliases
Gene description & Other designations Description:   cytochrome c oxidase subunit 6b-1      Other designations:   cytochrome c oxidase subunit 6b-1
Chromosome, Strand & Exon count Chromosome:   LG2     Strand:   plus     Exon count:   5
Gene Location within genomic sequence Genomic accession No. NC_024127.1      Gene Start and end within genomic accession: 5212332 ...... 5215745
CDS Sequence 103319564
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (CAA)3
Repeat start & end within CDS Repeat start: 365     Repeat end: 373
Forward primer Primer sequence:   CAGCTGAAGAGACACCTGCA     Tm(°C): 59.966     GC (%): 55     Size: 20
Reverse primer Primer sequence:   TTGTCACACTCTGGAGCACC     Tm(°C): 59.893     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 307     End: 457     Product size (bp): 151
JBrowse View      JBrowse

Enzyme Id:  K02267

Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103319564     NCBI Gene Symbol: LOC103319564
Gene Aliases
Gene description & Other designations Description:   cytochrome c oxidase subunit 6b-1      Other designations:   cytochrome c oxidase subunit 6b-1
Chromosome, Strand & Exon count Chromosome:   LG2     Strand:   plus     Exon count:   5
Gene Location within genomic sequence Genomic accession No. NC_024127.1      Gene Start and end within genomic accession: 5212332 ...... 5215745
CDS Sequence 103319564
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Hexa     Repeat sequence: (AAACCC)2
Repeat start & end within CDS Repeat start: 23     Repeat end: 34
Forward primer Primer sequence:   None     Tm(°C):      GC (%):      Size:
Reverse primer Primer sequence:   None     Tm(°C):      GC (%):      Size:
Primer start, end within sequence and product size Start:      End:      Product size (bp):
JBrowse View      JBrowse

Enzyme Id:  K02267

Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103319564     NCBI Gene Symbol: LOC103319564
Gene Aliases
Gene description & Other designations Description:   cytochrome c oxidase subunit 6b-1      Other designations:   cytochrome c oxidase subunit 6b-1
Chromosome, Strand & Exon count Chromosome:   LG2     Strand:   plus     Exon count:   5
Gene Location within genomic sequence Genomic accession No. NC_024127.1      Gene Start and end within genomic accession: 5212332 ...... 5215745
CDS Sequence 103319564
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   CAGCTGAAGAGACACCTGCA     Tm(°C): 59.966     GC (%): 55     Size: 20
Reverse primer Primer sequence:   TTGTCACACTCTGGAGCACC     Tm(°C): 59.893     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 307     End: 457     Product size (bp): 151
JBrowse View      JBrowse

Enzyme Id:  K02267

Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103323356     NCBI Gene Symbol: LOC103323356
Gene Aliases
Gene description & Other designations Description:   cytochrome c oxidase subunit 6b-2      Other designations:   cytochrome c oxidase subunit 6b-2
Chromosome, Strand & Exon count Chromosome:   LG2     Strand:   minus     Exon count:   4
Gene Location within genomic sequence Genomic accession No. NC_024127.1      Gene Start and end within genomic accession: 34398524 ...... 34401331
CDS Sequence 103323356
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   TGGCAGCAAAGGGTGAAGAA     Tm(°C): 60.106     GC (%): 50     Size: 20
Reverse primer Primer sequence:   CATTCTCCCTCTGCTCGTCC     Tm(°C): 59.896     GC (%): 60     Size: 20
Primer start, end within sequence and product size Start: 106     End: 213     Product size (bp): 108
JBrowse View      JBrowse