Statistics
Number of enzymes: 1
Total Number of designed primers: 2
Number of PGTM primers: 1
Number of PMTM primers: 1
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103335732 NCBI Gene Symbol: LOC103335732 |
| Gene Aliases | |
| Gene description & Other designations | Description: cytochrome c oxidase subunit 6a; mitochondrial Other designations: cytochrome c oxidase subunit 6a; mitochondrial |
| Chromosome, Strand & Exon count | Chromosome: LG1 Strand: plus Exon count: 4 |
| Gene Location within genomic sequence | Genomic accession No. NC_024126.1 Gene Start and end within genomic accession: 18639744 ...... 18641744 |
| CDS Sequence | 103335732 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Tri Repeat sequence: (CTC)3 |
| Repeat start & end within CDS | Repeat start: 87 Repeat end: 95 |
| Forward primer | Primer sequence: ATGTCGATGGTCCGATCTGC Tm(°C): 59.967 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: GCCGTTTCATGAGCATCGTC Tm(°C): 59.973 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 6 End: 124 Product size (bp): 119 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103335732 NCBI Gene Symbol: LOC103335732 |
| Gene Aliases | |
| Gene description & Other designations | Description: cytochrome c oxidase subunit 6a; mitochondrial Other designations: cytochrome c oxidase subunit 6a; mitochondrial |
| Chromosome, Strand & Exon count | Chromosome: LG1 Strand: plus Exon count: 4 |
| Gene Location within genomic sequence | Genomic accession No. NC_024126.1 Gene Start and end within genomic accession: 18639744 ...... 18641744 |
| CDS Sequence | 103335732 |
| Marker Information | |
| Marker Type | PGTM |
| Repeat type & sequence | Repeat type: Repeat sequence: |
| Repeat start & end within CDS | Repeat start: Repeat end: |
| Forward primer | Primer sequence: ATGTCGATGGTCCGATCTGC Tm(°C): 59.967 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: GCCGTTTCATGAGCATCGTC Tm(°C): 59.973 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 6 End: 124 Product size (bp): 119 |
| JBrowse View | JBrowse |
