Statistics
Number of enzymes: 1
Total Number of designed primers: 2
Number of PGTM primers: 1
Number of PMTM primers: 1
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103326208 NCBI Gene Symbol: LOC103326208 |
| Gene Aliases | |
| Gene description & Other designations | Description: cytochrome c oxidase copper chaperone 1 Other designations: cytochrome c oxidase copper chaperone 1 |
| Chromosome, Strand & Exon count | Chromosome: LG3 Strand: plus Exon count: 1 |
| Gene Location within genomic sequence | Genomic accession No. NC_024128.1 Gene Start and end within genomic accession: 11899433 ...... 11899989 |
| CDS Sequence | 103326208 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Tri Repeat sequence: (GAA)3 |
| Repeat start & end within CDS | Repeat start: 108 Repeat end: 116 |
| Forward primer | Primer sequence: ACTACTGCACCTAGCCTGGA Tm(°C): 59.959 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: AAGCCTCTTGACCATGCTCC Tm(°C): 60.035 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 78 End: 186 Product size (bp): 109 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103326208 NCBI Gene Symbol: LOC103326208 |
| Gene Aliases | |
| Gene description & Other designations | Description: cytochrome c oxidase copper chaperone 1 Other designations: cytochrome c oxidase copper chaperone 1 |
| Chromosome, Strand & Exon count | Chromosome: LG3 Strand: plus Exon count: 1 |
| Gene Location within genomic sequence | Genomic accession No. NC_024128.1 Gene Start and end within genomic accession: 11899433 ...... 11899989 |
| CDS Sequence | 103326208 |
| Marker Information | |
| Marker Type | PGTM |
| Repeat type & sequence | Repeat type: Repeat sequence: |
| Repeat start & end within CDS | Repeat start: Repeat end: |
| Forward primer | Primer sequence: ACTACTGCACCTAGCCTGGA Tm(°C): 59.959 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: AAGCCTCTTGACCATGCTCC Tm(°C): 60.035 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 78 End: 186 Product size (bp): 109 |
| JBrowse View | JBrowse |
