Statistics
Number of enzymes: 1
Total Number of designed primers: 2
Number of PGTM primers: 1
Number of PMTM primers: 1
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 101268533 NCBI Gene Symbol: LOC101268533 |
| Gene Aliases | |
| Gene description & Other designations | Description: cytochrome c oxidase assembly protein COX15 Other designations: cytochrome c oxidase assembly protein COX15 |
| Chromosome, Strand & Exon count | Chromosome: 11 Strand: plus Exon count: 7 |
| Gene Location within genomic sequence | Genomic accession No. NC_015448.3 Gene Start and end within genomic accession: 1491988 ...... 1496090 |
| CDS Sequence | 101268533 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Penta Repeat sequence: (TCTTC)2 |
| Repeat start & end within CDS | Repeat start: 148 Repeat end: 157 |
| Forward primer | Primer sequence: TGGGTGTCAAGATTTCGTCGA Tm(°C): 59.658 GC (%): 47.619 Size: 21 |
| Reverse primer | Primer sequence: GCAGCCACCGTGGAAATTTT Tm(°C): 59.967 GC (%): 50 Size: 20 |
| Primer start, end within sequence and product size | Start: 46 End: 286 Product size (bp): 241 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 101268533 NCBI Gene Symbol: LOC101268533 |
| Gene Aliases | |
| Gene description & Other designations | Description: cytochrome c oxidase assembly protein COX15 Other designations: cytochrome c oxidase assembly protein COX15 |
| Chromosome, Strand & Exon count | Chromosome: 11 Strand: plus Exon count: 7 |
| Gene Location within genomic sequence | Genomic accession No. NC_015448.3 Gene Start and end within genomic accession: 1491988 ...... 1496090 |
| CDS Sequence | 101268533 |
| Marker Information | |
| Marker Type | PGTM |
| Repeat type & sequence | Repeat type: Repeat sequence: |
| Repeat start & end within CDS | Repeat start: Repeat end: |
| Forward primer | Primer sequence: AAAATTTCCACGGTGGCTGC Tm(°C): 59.967 GC (%): 50 Size: 20 |
| Reverse primer | Primer sequence: TGTTAGAGGAGGGAGGCTCC Tm(°C): 60.032 GC (%): 60 Size: 20 |
| Primer start, end within sequence and product size | Start: 267 End: 485 Product size (bp): 219 |
| JBrowse View | JBrowse |
