|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 107881402 NCBI Gene Symbol: LOC107881402 |
| Gene Aliases | |
| Gene description & Other designations | Description: cytochrome c oxidase assembly protein COX15-like Other designations: cytochrome c oxidase assembly protein COX15-like |
| Chromosome, Strand & Exon count | Chromosome: LG6 Strand: minus Exon count: 9 |
| Gene Location within genomic sequence | Genomic accession No. NC_024131.1 Gene Start and end within genomic accession: 11985288 ...... 11993015 |
| CDS Sequence | 107881402 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Penta Repeat sequence: (AGGTA)2 |
| Repeat start & end within CDS | Repeat start: 1131 Repeat end: 1140 |
| Forward primer | Primer sequence: CACACCCAACTTGACAAGCG Tm(°C): 59.971 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: TCTGCTGTCATGCTCACAGG Tm(°C): 60.037 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 990 End: 1249 Product size (bp): 260 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 107881402 NCBI Gene Symbol: LOC107881402 |
| Gene Aliases | |
| Gene description & Other designations | Description: cytochrome c oxidase assembly protein COX15-like Other designations: cytochrome c oxidase assembly protein COX15-like |
| Chromosome, Strand & Exon count | Chromosome: LG6 Strand: minus Exon count: 9 |
| Gene Location within genomic sequence | Genomic accession No. NC_024131.1 Gene Start and end within genomic accession: 11985288 ...... 11993015 |
| CDS Sequence | 107881402 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Penta Repeat sequence: (AGGTA)2 |
| Repeat start & end within CDS | Repeat start: 1209 Repeat end: 1218 |
| Forward primer | Primer sequence: CACACCCAACTTGACAAGCG Tm(°C): 59.971 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: TCTGCTGTCATGCTCACAGG Tm(°C): 60.037 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 990 End: 1249 Product size (bp): 260 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 107881402 NCBI Gene Symbol: LOC107881402 |
| Gene Aliases | |
| Gene description & Other designations | Description: cytochrome c oxidase assembly protein COX15-like Other designations: cytochrome c oxidase assembly protein COX15-like |
| Chromosome, Strand & Exon count | Chromosome: LG6 Strand: minus Exon count: 9 |
| Gene Location within genomic sequence | Genomic accession No. NC_024131.1 Gene Start and end within genomic accession: 11985288 ...... 11993015 |
| CDS Sequence | 107881402 |
| Marker Information | |
| Marker Type | PGTM |
| Repeat type & sequence | Repeat type: Repeat sequence: |
| Repeat start & end within CDS | Repeat start: Repeat end: |
| Forward primer | Primer sequence: GGGCTTCCTCCTCTCTCAGA Tm(°C): 60.033 GC (%): 60 Size: 20 |
| Reverse primer | Primer sequence: GACAAGGGCAACGCAAACAT Tm(°C): 59.968 GC (%): 50 Size: 20 |
| Primer start, end within sequence and product size | Start: 198 End: 379 Product size (bp): 182 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103335619 NCBI Gene Symbol: LOC103335619 |
| Gene Aliases | |
| Gene description & Other designations | Description: cytochrome c oxidase assembly protein COX15-like Other designations: cytochrome c oxidase assembly protein COX15-like |
| Chromosome, Strand & Exon count | Chromosome: LG6 Strand: plus Exon count: 7 |
| Gene Location within genomic sequence | Genomic accession No. NC_024131.1 Gene Start and end within genomic accession: 10756930 ...... 10760032 |
| CDS Sequence | 103335619 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Hexa Repeat sequence: (TGCAAC)2 |
| Repeat start & end within CDS | Repeat start: 1065 Repeat end: 1076 |
| Forward primer | Primer sequence: GTTCATGGGGCAGCTAAGGT Tm(°C): 60.034 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: GTTGACCACCACAAAGCACC Tm(°C): 59.898 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 837 End: 1108 Product size (bp): 272 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103326605 NCBI Gene Symbol: LOC103326605 |
| Gene Aliases | |
| Gene description & Other designations | Description: cytochrome c oxidase assembly protein COX15 Other designations: cytochrome c oxidase assembly protein COX15 |
| Chromosome, Strand & Exon count | Chromosome: LG3 Strand: minus Exon count: 10 |
| Gene Location within genomic sequence | Genomic accession No. NC_024128.1 Gene Start and end within genomic accession: 15192054 ...... 15197664 |
| CDS Sequence | 103326605 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Tri Repeat sequence: (GAA)3 |
| Repeat start & end within CDS | Repeat start: 33 Repeat end: 41 |
| Forward primer | Primer sequence: ATGTTTCGGAGCCAAGTCGT Tm(°C): 59.965 GC (%): 50 Size: 20 |
| Reverse primer | Primer sequence: ATGCAGCAGAGCCAAAAAGC Tm(°C): 60.038 GC (%): 50 Size: 20 |
| Primer start, end within sequence and product size | Start: 0 End: 306 Product size (bp): 307 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103326605 NCBI Gene Symbol: LOC103326605 |
| Gene Aliases | |
| Gene description & Other designations | Description: cytochrome c oxidase assembly protein COX15 Other designations: cytochrome c oxidase assembly protein COX15 |
| Chromosome, Strand & Exon count | Chromosome: LG3 Strand: minus Exon count: 10 |
| Gene Location within genomic sequence | Genomic accession No. NC_024128.1 Gene Start and end within genomic accession: 15192054 ...... 15197664 |
| CDS Sequence | 103326605 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Hexa Repeat sequence: (TGCAAC)2 |
| Repeat start & end within CDS | Repeat start: 1065 Repeat end: 1076 |
| Forward primer | Primer sequence: TCACTAGCTTGGGTTCGTGG Tm(°C): 59.68 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: GTTGACCACCACAAAGCACC Tm(°C): 59.898 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 825 End: 1108 Product size (bp): 284 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103326605 NCBI Gene Symbol: LOC103326605 |
| Gene Aliases | |
| Gene description & Other designations | Description: cytochrome c oxidase assembly protein COX15 Other designations: cytochrome c oxidase assembly protein COX15 |
| Chromosome, Strand & Exon count | Chromosome: LG3 Strand: minus Exon count: 10 |
| Gene Location within genomic sequence | Genomic accession No. NC_024128.1 Gene Start and end within genomic accession: 15192054 ...... 15197664 |
| CDS Sequence | 103326605 |
| Marker Information | |
| Marker Type | PGTM |
| Repeat type & sequence | Repeat type: Repeat sequence: |
| Repeat start & end within CDS | Repeat start: Repeat end: |
| Forward primer | Primer sequence: ATGTTTCGGAGCCAAGTCGT Tm(°C): 59.965 GC (%): 50 Size: 20 |
| Reverse primer | Primer sequence: GGGGACTGCTTGTACTTCCC Tm(°C): 60.035 GC (%): 60 Size: 20 |
| Primer start, end within sequence and product size | Start: 0 End: 451 Product size (bp): 452 |
| JBrowse View | JBrowse |
