Statistics
Number of enzymes: 1
Total Number of designed primers: 7
Number of PGTM primers: 2
Number of PMTM primers: 5
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103342309 NCBI Gene Symbol: LOC103342309 |
| Gene Aliases | |
| Gene description & Other designations | Description: cytochrome c oxidase assembly protein COX11; mitochondrial-like Other designations: cytochrome c oxidase assembly protein COX11; mitochondrial-like |
| Chromosome, Strand & Exon count | Chromosome: Un Strand: Exon count: |
| Gene Location within genomic sequence | Genomic accession No. Gene Start and end within genomic accession: ...... |
| CDS Sequence | 103342309 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Penta Repeat sequence: (CCCTT)2 |
| Repeat start & end within CDS | Repeat start: 29 Repeat end: 38 |
| Forward primer | Primer sequence: TGTCGTGGTCAAGGGTTTGT Tm(°C): 59.746 GC (%): 50 Size: 20 |
| Reverse primer | Primer sequence: AGCGCCAAATAGGACTACCG Tm(°C): 59.896 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 1 End: 165 Product size (bp): 165 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103342309 NCBI Gene Symbol: LOC103342309 |
| Gene Aliases | |
| Gene description & Other designations | Description: cytochrome c oxidase assembly protein COX11; mitochondrial-like Other designations: cytochrome c oxidase assembly protein COX11; mitochondrial-like |
| Chromosome, Strand & Exon count | Chromosome: Un Strand: Exon count: |
| Gene Location within genomic sequence | Genomic accession No. Gene Start and end within genomic accession: ...... |
| CDS Sequence | 103342309 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Tri Repeat sequence: (TAG)3 |
| Repeat start & end within CDS | Repeat start: 114 Repeat end: 122 |
| Forward primer | Primer sequence: TGTCGTGGTCAAGGGTTTGT Tm(°C): 59.746 GC (%): 50 Size: 20 |
| Reverse primer | Primer sequence: AGCGCCAAATAGGACTACCG Tm(°C): 59.896 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 1 End: 165 Product size (bp): 165 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103342309 NCBI Gene Symbol: LOC103342309 |
| Gene Aliases | |
| Gene description & Other designations | Description: cytochrome c oxidase assembly protein COX11; mitochondrial-like Other designations: cytochrome c oxidase assembly protein COX11; mitochondrial-like |
| Chromosome, Strand & Exon count | Chromosome: Un Strand: Exon count: |
| Gene Location within genomic sequence | Genomic accession No. Gene Start and end within genomic accession: ...... |
| CDS Sequence | 103342309 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Penta Repeat sequence: (GTTCA)2 |
| Repeat start & end within CDS | Repeat start: 466 Repeat end: 475 |
| Forward primer | Primer sequence: CAGAAGATTGCTCGGCATGC Tm(°C): 59.971 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: AGGCATGTCAATCTGCTCCC Tm(°C): 60.107 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 411 End: 713 Product size (bp): 303 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103342309 NCBI Gene Symbol: LOC103342309 |
| Gene Aliases | |
| Gene description & Other designations | Description: cytochrome c oxidase assembly protein COX11; mitochondrial-like Other designations: cytochrome c oxidase assembly protein COX11; mitochondrial-like |
| Chromosome, Strand & Exon count | Chromosome: Un Strand: Exon count: |
| Gene Location within genomic sequence | Genomic accession No. Gene Start and end within genomic accession: ...... |
| CDS Sequence | 103342309 |
| Marker Information | |
| Marker Type | PGTM |
| Repeat type & sequence | Repeat type: Repeat sequence: |
| Repeat start & end within CDS | Repeat start: Repeat end: |
| Forward primer | Primer sequence: TGTCCAACGTCGTGAGAGTG Tm(°C): 59.97 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: ATCAGCCACGTCAGCATTGA Tm(°C): 60.036 GC (%): 50 Size: 20 |
| Primer start, end within sequence and product size | Start: 386 End: 491 Product size (bp): 106 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103329894 NCBI Gene Symbol: LOC103329894 |
| Gene Aliases | |
| Gene description & Other designations | Description: cytochrome c oxidase assembly protein COX11; mitochondrial-like Other designations: cytochrome c oxidase assembly protein COX11; mitochondrial-like |
| Chromosome, Strand & Exon count | Chromosome: LG4 Strand: minus Exon count: 8 |
| Gene Location within genomic sequence | Genomic accession No. NC_024129.1 Gene Start and end within genomic accession: 21232063 ...... 21234752 |
| CDS Sequence | 103329894 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Tri Repeat sequence: (GTA)3 |
| Repeat start & end within CDS | Repeat start: 113 Repeat end: 121 |
| Forward primer | Primer sequence: AGGGTTTGCAAAAGAGCCCT Tm(°C): 60.106 GC (%): 50 Size: 20 |
| Reverse primer | Primer sequence: CGAGCTTGAAGCCCCAACTA Tm(°C): 60.036 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 12 End: 177 Product size (bp): 166 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103329894 NCBI Gene Symbol: LOC103329894 |
| Gene Aliases | |
| Gene description & Other designations | Description: cytochrome c oxidase assembly protein COX11; mitochondrial-like Other designations: cytochrome c oxidase assembly protein COX11; mitochondrial-like |
| Chromosome, Strand & Exon count | Chromosome: LG4 Strand: minus Exon count: 8 |
| Gene Location within genomic sequence | Genomic accession No. NC_024129.1 Gene Start and end within genomic accession: 21232063 ...... 21234752 |
| CDS Sequence | 103329894 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Penta Repeat sequence: (GGTTT)2 |
| Repeat start & end within CDS | Repeat start: 304 Repeat end: 313 |
| Forward primer | Primer sequence: TGTTGAGAATCCAGCGACCC Tm(°C): 60.036 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: TGCCTCCATACCCAGTAGCT Tm(°C): 60.031 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 226 End: 387 Product size (bp): 162 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103329894 NCBI Gene Symbol: LOC103329894 |
| Gene Aliases | |
| Gene description & Other designations | Description: cytochrome c oxidase assembly protein COX11; mitochondrial-like Other designations: cytochrome c oxidase assembly protein COX11; mitochondrial-like |
| Chromosome, Strand & Exon count | Chromosome: LG4 Strand: minus Exon count: 8 |
| Gene Location within genomic sequence | Genomic accession No. NC_024129.1 Gene Start and end within genomic accession: 21232063 ...... 21234752 |
| CDS Sequence | 103329894 |
| Marker Information | |
| Marker Type | PGTM |
| Repeat type & sequence | Repeat type: Repeat sequence: |
| Repeat start & end within CDS | Repeat start: Repeat end: |
| Forward primer | Primer sequence: TGTTGAGAATCCAGCGACCC Tm(°C): 60.036 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: TGCCTCCATACCCAGTAGCT Tm(°C): 60.031 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 226 End: 387 Product size (bp): 162 |
| JBrowse View | JBrowse |
