Statistics
Number of enzymes: 1
Total Number of designed primers: 3
Number of PGTM primers: 1
Number of PMTM primers: 2
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 109850954 NCBI Gene Symbol: LOC109850954 |
| Gene Aliases | A4U43_C01F7470 |
| Gene description & Other designations | Description: phosphopantetheine adenylyltransferase 1 Other designations: phosphopantetheine adenylyltransferase 1 |
| Chromosome, Strand & Exon count | Chromosome: 1 Strand: minus Exon count: 6 |
| Gene Location within genomic sequence | Genomic accession No. NC_033794.1 Gene Start and end within genomic accession: 13732647 ...... 13740422 |
| CDS Sequence | 109850954 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Compound Repeat sequence: (AG)4gatcgtggttggggtctgcgacgggccgatgctagtaaaaaaagagct(A
GCTG)2 |
| Repeat start & end within CDS | Repeat start: 139 Repeat end: 204 |
| Forward primer | Primer sequence: ACGAACTCGAATCAGGGTCG Tm(°C): 59.829 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: CACTTGCACAACCAACCCTG Tm(°C): 59.897 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 10 End: 281 Product size (bp): 272 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 109850954 NCBI Gene Symbol: LOC109850954 |
| Gene Aliases | A4U43_C01F7470 |
| Gene description & Other designations | Description: phosphopantetheine adenylyltransferase 1 Other designations: phosphopantetheine adenylyltransferase 1 |
| Chromosome, Strand & Exon count | Chromosome: 1 Strand: minus Exon count: 6 |
| Gene Location within genomic sequence | Genomic accession No. NC_033794.1 Gene Start and end within genomic accession: 13732647 ...... 13740422 |
| CDS Sequence | 109850954 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Penta Repeat sequence: (AAGCT)2 |
| Repeat start & end within CDS | Repeat start: 460 Repeat end: 469 |
| Forward primer | Primer sequence: GGCAGGTGGTCATTCGGTAA Tm(°C): 60.036 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: GCTATGGGCTGCTCTTTGGA Tm(°C): 60.107 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 359 End: 529 Product size (bp): 171 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 109850954 NCBI Gene Symbol: LOC109850954 |
| Gene Aliases | A4U43_C01F7470 |
| Gene description & Other designations | Description: phosphopantetheine adenylyltransferase 1 Other designations: phosphopantetheine adenylyltransferase 1 |
| Chromosome, Strand & Exon count | Chromosome: 1 Strand: minus Exon count: 6 |
| Gene Location within genomic sequence | Genomic accession No. NC_033794.1 Gene Start and end within genomic accession: 13732647 ...... 13740422 |
| CDS Sequence | 109850954 |
| Marker Information | |
| Marker Type | PGTM |
| Repeat type & sequence | Repeat type: Repeat sequence: |
| Repeat start & end within CDS | Repeat start: Repeat end: |
| Forward primer | Primer sequence: CAGGGTTGGTTGTGCAAGTG Tm(°C): 59.897 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: TTACCGAATGACCACCTGCC Tm(°C): 60.036 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 262 End: 378 Product size (bp): 117 |
| JBrowse View | JBrowse |
