image


Statistics

Number of enzymes: 1
Total Number of designed primers: 23
Number of PGTM primers:     5
Number of PMTM primers:     18
Number of Failed designed PMTM primers: 2

Enzyme Id:  K02154
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103339076     NCBI Gene Symbol: LOC103339076
Gene Aliases
Gene description & Other designations Description:   V-type proton ATPase subunit a1-like      Other designations:   V-type proton ATPase subunit a1-like
Chromosome, Strand & Exon count Chromosome:   LG8     Strand:   plus     Exon count:   19
Gene Location within genomic sequence Genomic accession No. NC_024133.1      Gene Start and end within genomic accession: 1386578 ...... 1406862
CDS Sequence 103339076
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (ATG)4
Repeat start & end within CDS Repeat start: 272     Repeat end: 283
Forward primer Primer sequence:   GAACCCCCAGTCTGCTCATC     Tm(°C): 60.107     GC (%): 60     Size: 20
Reverse primer Primer sequence:   TTTCTGTGACGGATCCCTGC     Tm(°C): 60.036     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 149     End: 340     Product size (bp): 192
JBrowse View      JBrowse

Enzyme Id:  K02154
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103339076     NCBI Gene Symbol: LOC103339076
Gene Aliases
Gene description & Other designations Description:   V-type proton ATPase subunit a1-like      Other designations:   V-type proton ATPase subunit a1-like
Chromosome, Strand & Exon count Chromosome:   LG8     Strand:   plus     Exon count:   19
Gene Location within genomic sequence Genomic accession No. NC_024133.1      Gene Start and end within genomic accession: 1386578 ...... 1406862
CDS Sequence 103339076
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Hexa     Repeat sequence: (AAAATG)2
Repeat start & end within CDS Repeat start: 1069     Repeat end: 1080
Forward primer Primer sequence:   CCCATTTGGTGTGGATCCCA     Tm(°C): 59.959     GC (%): 55     Size: 20
Reverse primer Primer sequence:   AAGTTCATTTGCGCCACACC     Tm(°C): 59.968     GC (%): 50     Size: 20
Primer start, end within sequence and product size Start: 1004     End: 1111     Product size (bp): 108
JBrowse View      JBrowse

Enzyme Id:  K02154
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103339076     NCBI Gene Symbol: LOC103339076
Gene Aliases
Gene description & Other designations Description:   V-type proton ATPase subunit a1-like      Other designations:   V-type proton ATPase subunit a1-like
Chromosome, Strand & Exon count Chromosome:   LG8     Strand:   plus     Exon count:   19
Gene Location within genomic sequence Genomic accession No. NC_024133.1      Gene Start and end within genomic accession: 1386578 ...... 1406862
CDS Sequence 103339076
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (TGA)4
Repeat start & end within CDS Repeat start: 1731     Repeat end: 1742
Forward primer Primer sequence:   GAGCTTGGCCCACTCAGAAT     Tm(°C): 60.035     GC (%): 55     Size: 20
Reverse primer Primer sequence:   ACTCCCTGAGTGTTCCCTGA     Tm(°C): 59.809     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 1628     End: 1791     Product size (bp): 164
JBrowse View      JBrowse

Enzyme Id:  K02154
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103339076     NCBI Gene Symbol: LOC103339076
Gene Aliases
Gene description & Other designations Description:   V-type proton ATPase subunit a1-like      Other designations:   V-type proton ATPase subunit a1-like
Chromosome, Strand & Exon count Chromosome:   LG8     Strand:   plus     Exon count:   19
Gene Location within genomic sequence Genomic accession No. NC_024133.1      Gene Start and end within genomic accession: 1386578 ...... 1406862
CDS Sequence 103339076
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (AAGTA)2
Repeat start & end within CDS Repeat start: 2102     Repeat end: 2111
Forward primer Primer sequence:   TATTGGAGGCGTTGTGACCC     Tm(°C): 60.036     GC (%): 55     Size: 20
Reverse primer Primer sequence:   ACGGTCCTTTCGATTGGCAT     Tm(°C): 60.035     GC (%): 50     Size: 20
Primer start, end within sequence and product size Start: 2051     End: 2211     Product size (bp): 161
JBrowse View      JBrowse

Enzyme Id:  K02154
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103339076     NCBI Gene Symbol: LOC103339076
Gene Aliases
Gene description & Other designations Description:   V-type proton ATPase subunit a1-like      Other designations:   V-type proton ATPase subunit a1-like
Chromosome, Strand & Exon count Chromosome:   LG8     Strand:   plus     Exon count:   19
Gene Location within genomic sequence Genomic accession No. NC_024133.1      Gene Start and end within genomic accession: 1386578 ...... 1406862
CDS Sequence 103339076
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (GAG)3
Repeat start & end within CDS Repeat start: 2332     Repeat end: 2340
Forward primer Primer sequence:   ATGCCAATCGAAAGGACCGT     Tm(°C): 60.035     GC (%): 50     Size: 20
Reverse primer Primer sequence:   AATCCCCCTTAGACTCGCCT     Tm(°C): 60.031     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 2192     End: 2531     Product size (bp): 340
JBrowse View      JBrowse

Enzyme Id:  K02154
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103339076     NCBI Gene Symbol: LOC103339076
Gene Aliases
Gene description & Other designations Description:   V-type proton ATPase subunit a1-like      Other designations:   V-type proton ATPase subunit a1-like
Chromosome, Strand & Exon count Chromosome:   LG8     Strand:   plus     Exon count:   19
Gene Location within genomic sequence Genomic accession No. NC_024133.1      Gene Start and end within genomic accession: 1386578 ...... 1406862
CDS Sequence 103339076
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (TGA)3
Repeat start & end within CDS Repeat start: 2661     Repeat end: 2669
Forward primer Primer sequence:   AGGCGAGTCTAAGGGGGATT     Tm(°C): 60.031     GC (%): 55     Size: 20
Reverse primer Primer sequence:   TCATTGCCTGAGTCGTCACC     Tm(°C): 60.037     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 2512     End: 2830     Product size (bp): 319
JBrowse View      JBrowse

Enzyme Id:  K02154
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103339076     NCBI Gene Symbol: LOC103339076
Gene Aliases
Gene description & Other designations Description:   V-type proton ATPase subunit a1-like      Other designations:   V-type proton ATPase subunit a1-like
Chromosome, Strand & Exon count Chromosome:   LG8     Strand:   plus     Exon count:   19
Gene Location within genomic sequence Genomic accession No. NC_024133.1      Gene Start and end within genomic accession: 1386578 ...... 1406862
CDS Sequence 103339076
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   ATGCCAATCGAAAGGACCGT     Tm(°C): 60.035     GC (%): 50     Size: 20
Reverse primer Primer sequence:   AATCCCCCTTAGACTCGCCT     Tm(°C): 60.031     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 2192     End: 2531     Product size (bp): 340
JBrowse View      JBrowse

Enzyme Id:  K02154
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103335716     NCBI Gene Symbol: LOC103335716
Gene Aliases
Gene description & Other designations Description:   V-type proton ATPase subunit a3      Other designations:   V-type proton ATPase subunit a3|vacuolar proton ATPase a3
Chromosome, Strand & Exon count Chromosome:   LG6     Strand:   minus     Exon count:   18
Gene Location within genomic sequence Genomic accession No. NC_024131.1      Gene Start and end within genomic accession: 11733313 ...... 11743751
CDS Sequence 103335716
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Compound     Repeat sequence: (ATC)3cccatcgagtctg(CTCAC)2
Repeat start & end within CDS Repeat start: 61     Repeat end: 92
Forward primer Primer sequence:   GCTGTCCTCCGATGGATCTG     Tm(°C): 59.967     GC (%): 60     Size: 20
Reverse primer Primer sequence:   CGAGCCATCTCTGCACATCT     Tm(°C): 59.896     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 10     End: 205     Product size (bp): 196
JBrowse View      JBrowse

Enzyme Id:  K02154
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103335716     NCBI Gene Symbol: LOC103335716
Gene Aliases
Gene description & Other designations Description:   V-type proton ATPase subunit a3      Other designations:   V-type proton ATPase subunit a3|vacuolar proton ATPase a3
Chromosome, Strand & Exon count Chromosome:   LG6     Strand:   minus     Exon count:   18
Gene Location within genomic sequence Genomic accession No. NC_024131.1      Gene Start and end within genomic accession: 11733313 ...... 11743751
CDS Sequence 103335716
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (AAGTT)2
Repeat start & end within CDS Repeat start: 545     Repeat end: 554
Forward primer Primer sequence:   CGCGTTGCAGCAAAGAGAAA     Tm(°C): 60.317     GC (%): 50     Size: 20
Reverse primer Primer sequence:   CAGCCTGCCTCAGAAAGACA     Tm(°C): 59.964     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 443     End: 651     Product size (bp): 209
JBrowse View      JBrowse

Enzyme Id:  K02154
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103335716     NCBI Gene Symbol: LOC103335716
Gene Aliases
Gene description & Other designations Description:   V-type proton ATPase subunit a3      Other designations:   V-type proton ATPase subunit a3|vacuolar proton ATPase a3
Chromosome, Strand & Exon count Chromosome:   LG6     Strand:   minus     Exon count:   18
Gene Location within genomic sequence Genomic accession No. NC_024131.1      Gene Start and end within genomic accession: 11733313 ...... 11743751
CDS Sequence 103335716
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Compound     Repeat sequence: (CA)4ggaggcaccacctacctatttccgcacaaacaaattca(CTT)3
Repeat start & end within CDS Repeat start: 1117     Repeat end: 1171
Forward primer Primer sequence:   GCAGCGTTTGACTCCAACTC     Tm(°C): 59.764     GC (%): 55     Size: 20
Reverse primer Primer sequence:   CCACCAAAGGCCATCTCCAT     Tm(°C): 60.033     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 1068     End: 1384     Product size (bp): 317
JBrowse View      JBrowse

Enzyme Id:  K02154
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103335716     NCBI Gene Symbol: LOC103335716
Gene Aliases
Gene description & Other designations Description:   V-type proton ATPase subunit a3      Other designations:   V-type proton ATPase subunit a3|vacuolar proton ATPase a3
Chromosome, Strand & Exon count Chromosome:   LG6     Strand:   minus     Exon count:   18
Gene Location within genomic sequence Genomic accession No. NC_024131.1      Gene Start and end within genomic accession: 11733313 ...... 11743751
CDS Sequence 103335716
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (GTTAT)2
Repeat start & end within CDS Repeat start: 1388     Repeat end: 1397
Forward primer Primer sequence:   ATGGAGATGGCCTTTGGTGG     Tm(°C): 60.033     GC (%): 55     Size: 20
Reverse primer Primer sequence:   ACAGGATCCAGGCCAAATGG     Tm(°C): 60.033     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 1365     End: 1573     Product size (bp): 209
JBrowse View      JBrowse

Enzyme Id:  K02154
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103335716     NCBI Gene Symbol: LOC103335716
Gene Aliases
Gene description & Other designations Description:   V-type proton ATPase subunit a3      Other designations:   V-type proton ATPase subunit a3|vacuolar proton ATPase a3
Chromosome, Strand & Exon count Chromosome:   LG6     Strand:   minus     Exon count:   18
Gene Location within genomic sequence Genomic accession No. NC_024131.1      Gene Start and end within genomic accession: 11733313 ...... 11743751
CDS Sequence 103335716
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   ATGGAGATGGCCTTTGGTGG     Tm(°C): 60.033     GC (%): 55     Size: 20
Reverse primer Primer sequence:   ACAGGATCCAGGCCAAATGG     Tm(°C): 60.033     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 1365     End: 1573     Product size (bp): 209
JBrowse View      JBrowse

Enzyme Id:  K02154
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103321306     NCBI Gene Symbol: LOC103321306
Gene Aliases
Gene description & Other designations Description:   V-type proton ATPase subunit a3-like      Other designations:   V-type proton ATPase subunit a3-like
Chromosome, Strand & Exon count Chromosome:   LG2     Strand:   minus     Exon count:   18
Gene Location within genomic sequence Genomic accession No. NC_024127.1      Gene Start and end within genomic accession: 15799198 ...... 15805542
CDS Sequence 103321306
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (CGCCA)2
Repeat start & end within CDS Repeat start: 88     Repeat end: 97
Forward primer Primer sequence:   GGCGCAACTCATCATCCCTA     Tm(°C): 59.893     GC (%): 55     Size: 20
Reverse primer Primer sequence:   AGCCATTTCTCCACACCGTT     Tm(°C): 59.89     GC (%): 50     Size: 20
Primer start, end within sequence and product size Start: 56     End: 206     Product size (bp): 151
JBrowse View      JBrowse

Enzyme Id:  K02154
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103321306     NCBI Gene Symbol: LOC103321306
Gene Aliases
Gene description & Other designations Description:   V-type proton ATPase subunit a3-like      Other designations:   V-type proton ATPase subunit a3-like
Chromosome, Strand & Exon count Chromosome:   LG2     Strand:   minus     Exon count:   18
Gene Location within genomic sequence Genomic accession No. NC_024127.1      Gene Start and end within genomic accession: 15799198 ...... 15805542
CDS Sequence 103321306
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (TGC)3
Repeat start & end within CDS Repeat start: 447     Repeat end: 455
Forward primer Primer sequence:   TCGGTGAACTTGAAGCCGAG     Tm(°C): 60.32     GC (%): 55     Size: 20
Reverse primer Primer sequence:   CGGGTTGCACGAAACAGAAT     Tm(°C): 59.409     GC (%): 50     Size: 20
Primer start, end within sequence and product size Start: 313     End: 631     Product size (bp): 319
JBrowse View      JBrowse

Enzyme Id:  K02154
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103321306     NCBI Gene Symbol: LOC103321306
Gene Aliases
Gene description & Other designations Description:   V-type proton ATPase subunit a3-like      Other designations:   V-type proton ATPase subunit a3-like
Chromosome, Strand & Exon count Chromosome:   LG2     Strand:   minus     Exon count:   18
Gene Location within genomic sequence Genomic accession No. NC_024127.1      Gene Start and end within genomic accession: 15799198 ...... 15805542
CDS Sequence 103321306
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (CCTTT)2
Repeat start & end within CDS Repeat start: 1255     Repeat end: 1264
Forward primer Primer sequence:   ACGGGGTTGCCAAGTATCAG     Tm(°C): 60.035     GC (%): 55     Size: 20
Reverse primer Primer sequence:   AGCAAATACCATGGCCCCAA     Tm(°C): 59.958     GC (%): 50     Size: 20
Primer start, end within sequence and product size Start: 1198     End: 1302     Product size (bp): 105
JBrowse View      JBrowse

Enzyme Id:  K02154
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103321306     NCBI Gene Symbol: LOC103321306
Gene Aliases
Gene description & Other designations Description:   V-type proton ATPase subunit a3-like      Other designations:   V-type proton ATPase subunit a3-like
Chromosome, Strand & Exon count Chromosome:   LG2     Strand:   minus     Exon count:   18
Gene Location within genomic sequence Genomic accession No. NC_024127.1      Gene Start and end within genomic accession: 15799198 ...... 15805542
CDS Sequence 103321306
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Compound     Repeat sequence: (GTTAT)2t(ATG)3
Repeat start & end within CDS Repeat start: 1394     Repeat end: 1413
Forward primer Primer sequence:   TGGGGCCATGGTATTTGCTT     Tm(°C): 59.958     GC (%): 50     Size: 20
Reverse primer Primer sequence:   GTGCCACGGACCTTACTCAA     Tm(°C): 59.966     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 1284     End: 1555     Product size (bp): 272
JBrowse View      JBrowse

Enzyme Id:  K02154
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103321306     NCBI Gene Symbol: LOC103321306
Gene Aliases
Gene description & Other designations Description:   V-type proton ATPase subunit a3-like      Other designations:   V-type proton ATPase subunit a3-like
Chromosome, Strand & Exon count Chromosome:   LG2     Strand:   minus     Exon count:   18
Gene Location within genomic sequence Genomic accession No. NC_024127.1      Gene Start and end within genomic accession: 15799198 ...... 15805542
CDS Sequence 103321306
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Hexa     Repeat sequence: (TGAAGA)2
Repeat start & end within CDS Repeat start: 1622     Repeat end: 1633
Forward primer Primer sequence:   TTGAGTAAGGTCCGTGGCAC     Tm(°C): 59.966     GC (%): 55     Size: 20
Reverse primer Primer sequence:   CAGCTTGTGAACCAGTGCAC     Tm(°C): 59.97     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 1536     End: 1818     Product size (bp): 283
JBrowse View      JBrowse

Enzyme Id:  K02154
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103321306     NCBI Gene Symbol: LOC103321306
Gene Aliases
Gene description & Other designations Description:   V-type proton ATPase subunit a3-like      Other designations:   V-type proton ATPase subunit a3-like
Chromosome, Strand & Exon count Chromosome:   LG2     Strand:   minus     Exon count:   18
Gene Location within genomic sequence Genomic accession No. NC_024127.1      Gene Start and end within genomic accession: 15799198 ...... 15805542
CDS Sequence 103321306
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   TTGAGTAAGGTCCGTGGCAC     Tm(°C): 59.966     GC (%): 55     Size: 20
Reverse primer Primer sequence:   CAGCTTGTGAACCAGTGCAC     Tm(°C): 59.97     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 1536     End: 1818     Product size (bp): 283
JBrowse View      JBrowse

Enzyme Id:  K02154
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103323429     NCBI Gene Symbol: LOC103323429
Gene Aliases
Gene description & Other designations Description:   V-type proton ATPase subunit a1-like      Other designations:   V-type proton ATPase subunit a1-like
Chromosome, Strand & Exon count Chromosome:   LG2     Strand:   plus     Exon count:   11
Gene Location within genomic sequence Genomic accession No. NC_024127.1      Gene Start and end within genomic accession: 34702552 ...... 34709467
CDS Sequence 103323429
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Hexa     Repeat sequence: (AAAATG)2
Repeat start & end within CDS Repeat start: 805     Repeat end: 816
Forward primer Primer sequence:   CCCATTTGGTGTGGATCCCA     Tm(°C): 59.959     GC (%): 55     Size: 20
Reverse primer Primer sequence:   AAGTTCATTTGCGCCACACC     Tm(°C): 59.968     GC (%): 50     Size: 20
Primer start, end within sequence and product size Start: 740     End: 847     Product size (bp): 108
JBrowse View      JBrowse

Enzyme Id:  K02154
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103323429     NCBI Gene Symbol: LOC103323429
Gene Aliases
Gene description & Other designations Description:   V-type proton ATPase subunit a1-like      Other designations:   V-type proton ATPase subunit a1-like
Chromosome, Strand & Exon count Chromosome:   LG2     Strand:   plus     Exon count:   11
Gene Location within genomic sequence Genomic accession No. NC_024127.1      Gene Start and end within genomic accession: 34702552 ...... 34709467
CDS Sequence 103323429
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (CCCAA)2
Repeat start & end within CDS Repeat start: 1392     Repeat end: 1401
Forward primer Primer sequence:   None     Tm(°C):      GC (%):      Size:
Reverse primer Primer sequence:   None     Tm(°C):      GC (%):      Size:
Primer start, end within sequence and product size Start:      End:      Product size (bp):
JBrowse View      JBrowse

Enzyme Id:  K02154
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103323429     NCBI Gene Symbol: LOC103323429
Gene Aliases
Gene description & Other designations Description:   V-type proton ATPase subunit a1-like      Other designations:   V-type proton ATPase subunit a1-like
Chromosome, Strand & Exon count Chromosome:   LG2     Strand:   plus     Exon count:   11
Gene Location within genomic sequence Genomic accession No. NC_024127.1      Gene Start and end within genomic accession: 34702552 ...... 34709467
CDS Sequence 103323429
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   GGTGTGGCGCAAATGAACTT     Tm(°C): 59.968     GC (%): 50     Size: 20
Reverse primer Primer sequence:   CATCTCTGAGGTGCCAAGCA     Tm(°C): 60.036     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 828     End: 1217     Product size (bp): 390
JBrowse View      JBrowse

Enzyme Id:  K02154
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103324578     NCBI Gene Symbol: LOC103324578
Gene Aliases
Gene description & Other designations Description:   V-type proton ATPase subunit a1      Other designations:   V-type proton ATPase subunit a1
Chromosome, Strand & Exon count Chromosome:   LG1     Strand:   plus     Exon count:   18
Gene Location within genomic sequence Genomic accession No. NC_024126.1      Gene Start and end within genomic accession: 5881308 ...... 5897241
CDS Sequence 103324578
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Di     Repeat sequence: (GA)4
Repeat start & end within CDS Repeat start: 466     Repeat end: 473
Forward primer Primer sequence:   ATAGCCATGCGGTTCCAGAG     Tm(°C): 59.893     GC (%): 55     Size: 20
Reverse primer Primer sequence:   CTGCAGCCCTGAGAAGAACA     Tm(°C): 59.964     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 445     End: 749     Product size (bp): 305
JBrowse View      JBrowse

Enzyme Id:  K02154
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103324578     NCBI Gene Symbol: LOC103324578
Gene Aliases
Gene description & Other designations Description:   V-type proton ATPase subunit a1      Other designations:   V-type proton ATPase subunit a1
Chromosome, Strand & Exon count Chromosome:   LG1     Strand:   plus     Exon count:   18
Gene Location within genomic sequence Genomic accession No. NC_024126.1      Gene Start and end within genomic accession: 5881308 ...... 5897241
CDS Sequence 103324578
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Hexa     Repeat sequence: (AAAATG)2
Repeat start & end within CDS Repeat start: 1633     Repeat end: 1644
Forward primer Primer sequence:   CCCATTTGGTGTGGATCCCA     Tm(°C): 59.959     GC (%): 55     Size: 20
Reverse primer Primer sequence:   AAGTTCATTTGCGCCACACC     Tm(°C): 59.968     GC (%): 50     Size: 20
Primer start, end within sequence and product size Start: 1568     End: 1675     Product size (bp): 108
JBrowse View      JBrowse

Enzyme Id:  K02154
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103324578     NCBI Gene Symbol: LOC103324578
Gene Aliases
Gene description & Other designations Description:   V-type proton ATPase subunit a1      Other designations:   V-type proton ATPase subunit a1
Chromosome, Strand & Exon count Chromosome:   LG1     Strand:   plus     Exon count:   18
Gene Location within genomic sequence Genomic accession No. NC_024126.1      Gene Start and end within genomic accession: 5881308 ...... 5897241
CDS Sequence 103324578
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Hexa     Repeat sequence: (TGAGGA)2
Repeat start & end within CDS Repeat start: 2445     Repeat end: 2456
Forward primer Primer sequence:   None     Tm(°C):      GC (%):      Size:
Reverse primer Primer sequence:   None     Tm(°C):      GC (%):      Size:
Primer start, end within sequence and product size Start:      End:      Product size (bp):
JBrowse View      JBrowse

Enzyme Id:  K02154
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103324578     NCBI Gene Symbol: LOC103324578
Gene Aliases
Gene description & Other designations Description:   V-type proton ATPase subunit a1      Other designations:   V-type proton ATPase subunit a1
Chromosome, Strand & Exon count Chromosome:   LG1     Strand:   plus     Exon count:   18
Gene Location within genomic sequence Genomic accession No. NC_024126.1      Gene Start and end within genomic accession: 5881308 ...... 5897241
CDS Sequence 103324578
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   CATCATCCCCGTCGAGTCTG     Tm(°C): 59.969     GC (%): 60     Size: 20
Reverse primer Primer sequence:   GCCCAGGTCTGATATCCTGC     Tm(°C): 59.964     GC (%): 60     Size: 20
Primer start, end within sequence and product size Start: 71     End: 549     Product size (bp): 479
JBrowse View      JBrowse