Statistics
Number of enzymes: 1
Total Number of designed primers: 3
Number of PGTM primers: 2
Number of PMTM primers: 1
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103326564 NCBI Gene Symbol: LOC103326564 |
| Gene Aliases | |
| Gene description & Other designations | Description: V-type proton ATPase subunit e1 Other designations: V-type proton ATPase subunit e1|V-type proton ATPase subunit e |
| Chromosome, Strand & Exon count | Chromosome: LG3 Strand: minus Exon count: 4 |
| Gene Location within genomic sequence | Genomic accession No. NC_024128.1 Gene Start and end within genomic accession: 14732613 ...... 14735183 |
| CDS Sequence | 103326564 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Tri Repeat sequence: (CTG)3 |
| Repeat start & end within CDS | Repeat start: 132 Repeat end: 140 |
| Forward primer | Primer sequence: ACCAGAATTTGCTGCAACCG Tm(°C): 59.685 GC (%): 50 Size: 20 |
| Reverse primer | Primer sequence: TGAGTGGTTTCATTTGTGCAAG Tm(°C): 57.956 GC (%): 40.909 Size: 22 |
| Primer start, end within sequence and product size | Start: 60 End: 183 Product size (bp): 124 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103326564 NCBI Gene Symbol: LOC103326564 |
| Gene Aliases | |
| Gene description & Other designations | Description: V-type proton ATPase subunit e1 Other designations: V-type proton ATPase subunit e1|V-type proton ATPase subunit e |
| Chromosome, Strand & Exon count | Chromosome: LG3 Strand: minus Exon count: 4 |
| Gene Location within genomic sequence | Genomic accession No. NC_024128.1 Gene Start and end within genomic accession: 14732613 ...... 14735183 |
| CDS Sequence | 103326564 |
| Marker Information | |
| Marker Type | PGTM |
| Repeat type & sequence | Repeat type: Repeat sequence: |
| Repeat start & end within CDS | Repeat start: Repeat end: |
| Forward primer | Primer sequence: TGGGATCATTGCTTCTCTGTGT Tm(°C): 59.693 GC (%): 45.455 Size: 22 |
| Reverse primer | Primer sequence: ATTGCCCACATCATCCAGCA Tm(°C): 60.033 GC (%): 50 Size: 20 |
| Primer start, end within sequence and product size | Start: 38 End: 154 Product size (bp): 117 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103326996 NCBI Gene Symbol: LOC103326996 |
| Gene Aliases | |
| Gene description & Other designations | Description: V-type proton ATPase subunit e1-like Other designations: V-type proton ATPase subunit e1-like |
| Chromosome, Strand & Exon count | Chromosome: LG3 Strand: plus Exon count: 4 |
| Gene Location within genomic sequence | Genomic accession No. NC_024128.1 Gene Start and end within genomic accession: 20800968 ...... 20802687 |
| CDS Sequence | 103326996 |
| Marker Information | |
| Marker Type | PGTM |
| Repeat type & sequence | Repeat type: Repeat sequence: |
| Repeat start & end within CDS | Repeat start: Repeat end: |
| Forward primer | Primer sequence: TGGGCGTAATTGCTTCCCTT Tm(°C): 59.961 GC (%): 50 Size: 20 |
| Reverse primer | Primer sequence: TGAGCGGTTTCATCTGTGCA Tm(°C): 60.25 GC (%): 50 Size: 20 |
| Primer start, end within sequence and product size | Start: 37 End: 183 Product size (bp): 147 |
| JBrowse View | JBrowse |
