Statistics
Number of enzymes: 1
Total Number of designed primers: 4
Number of PGTM primers: 3
Number of PMTM primers: 1
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103343083 NCBI Gene Symbol: LOC103343083 |
| Gene Aliases | |
| Gene description & Other designations | Description: V-type proton ATPase subunit G 1-like Other designations: V-type proton ATPase subunit G 1-like |
| Chromosome, Strand & Exon count | Chromosome: Un Strand: Exon count: |
| Gene Location within genomic sequence | Genomic accession No. Gene Start and end within genomic accession: ...... |
| CDS Sequence | 103343083 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Tri Repeat sequence: (ATC)3 |
| Repeat start & end within CDS | Repeat start: 264 Repeat end: 272 |
| Forward primer | Primer sequence: TAACAGTGCCAGAACCGCAA Tm(°C): 60.179 GC (%): 50 Size: 20 |
| Reverse primer | Primer sequence: TGCTGACGATATCCGATCGG Tm(°C): 59.478 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 71 End: 297 Product size (bp): 227 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103343083 NCBI Gene Symbol: LOC103343083 |
| Gene Aliases | |
| Gene description & Other designations | Description: V-type proton ATPase subunit G 1-like Other designations: V-type proton ATPase subunit G 1-like |
| Chromosome, Strand & Exon count | Chromosome: Un Strand: Exon count: |
| Gene Location within genomic sequence | Genomic accession No. Gene Start and end within genomic accession: ...... |
| CDS Sequence | 103343083 |
| Marker Information | |
| Marker Type | PGTM |
| Repeat type & sequence | Repeat type: Repeat sequence: |
| Repeat start & end within CDS | Repeat start: Repeat end: |
| Forward primer | Primer sequence: ATTCCGTTCGAGGACAAGGC Tm(°C): 60.391 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: CAGCCTCCATATTGGTGCGA Tm(°C): 60.179 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 4 End: 165 Product size (bp): 162 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103342128 NCBI Gene Symbol: LOC103342128 |
| Gene Aliases | |
| Gene description & Other designations | Description: V-type proton ATPase subunit G-like Other designations: V-type proton ATPase subunit G-like |
| Chromosome, Strand & Exon count | Chromosome: Un Strand: Exon count: |
| Gene Location within genomic sequence | Genomic accession No. Gene Start and end within genomic accession: ...... |
| CDS Sequence | 103342128 |
| Marker Information | |
| Marker Type | PGTM |
| Repeat type & sequence | Repeat type: Repeat sequence: |
| Repeat start & end within CDS | Repeat start: Repeat end: |
| Forward primer | Primer sequence: ATTGCTGAATACCGTGCCCA Tm(°C): 60.035 GC (%): 50 Size: 20 |
| Reverse primer | Primer sequence: TTCTTCACCGTCGTCACCTG Tm(°C): 59.968 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 135 End: 328 Product size (bp): 194 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103327611 NCBI Gene Symbol: LOC103327611 |
| Gene Aliases | |
| Gene description & Other designations | Description: V-type proton ATPase subunit G-like Other designations: V-type proton ATPase subunit G-like |
| Chromosome, Strand & Exon count | Chromosome: LG4 Strand: minus Exon count: 4 |
| Gene Location within genomic sequence | Genomic accession No. NC_024129.1 Gene Start and end within genomic accession: 2668644 ...... 2670398 |
| CDS Sequence | 103327611 |
| Marker Information | |
| Marker Type | PGTM |
| Repeat type & sequence | Repeat type: Repeat sequence: |
| Repeat start & end within CDS | Repeat start: Repeat end: |
| Forward primer | Primer sequence: GTCAATGCTGCCAGAAGTGC Tm(°C): 60.109 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: GACGCTTCACATTAGCCCCT Tm(°C): 60.108 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 69 End: 222 Product size (bp): 154 |
| JBrowse View | JBrowse |
