Enzyme Id: K02151 |
||||||||||||||||||||||||||||||||||||||||||||||||
| Gene Information | ||||||||||||||||||||||||||||||||||||||||||||||||
| NCBI Gene Accession Number & Symbol | Accession Number: 103336637 NCBI Gene Symbol: LOC103336637 | |||||||||||||||||||||||||||||||||||||||||||||||
| Gene Aliases | ||||||||||||||||||||||||||||||||||||||||||||||||
| Gene description & Other designations | Description: V-type proton ATPase subunit F Other designations: V-type proton ATPase subunit F | |||||||||||||||||||||||||||||||||||||||||||||||
| Chromosome, Strand & Exon count | Chromosome: LG7 Strand: minus Exon count: 5 | |||||||||||||||||||||||||||||||||||||||||||||||
| Gene Location within genomic sequence | Genomic accession No. NC_024132.1 Gene Start and end within genomic accession: 414642 ...... 417077 | |||||||||||||||||||||||||||||||||||||||||||||||
| CDS Sequence | 103336637 | |||||||||||||||||||||||||||||||||||||||||||||||
| Marker Information | ||||||||||||||||||||||||||||||||||||||||||||||||
| Marker Type | PGTM | |||||||||||||||||||||||||||||||||||||||||||||||
| Repeat type & sequence | Repeat type: Repeat sequence: | |||||||||||||||||||||||||||||||||||||||||||||||
| Repeat start & end within CDS | Repeat start: Repeat end: | |||||||||||||||||||||||||||||||||||||||||||||||
| Forward primer | Primer sequence: GGCAGAGCTCATATCCCCAC Tm(°C): 59.964 GC (%): 60 Size: 20 | |||||||||||||||||||||||||||||||||||||||||||||||
| Reverse primer | Primer sequence: TCAACGTTACCCACTCCAGC Tm(°C): 59.966 GC (%): 55 Size: 20 | |||||||||||||||||||||||||||||||||||||||||||||||
| Primer start, end within sequence and product size | Start: 6 End: 106 Product size (bp): 101 | |||||||||||||||||||||||||||||||||||||||||||||||
| JBrowse View | JBrowse | |||||||||||||||||||||||||||||||||||||||||||||||
Enzyme Id: K02151 |
||
| Gene Information | ||
| NCBI Gene Accession Number & Symbol | Accession Number: 103325166 NCBI Gene Symbol: LOC103325166 | |
| Gene Aliases | ||
| Gene description & Other designations | Description: V-type proton ATPase subunit F-like Other designations: V-type proton ATPase subunit F-like | |
| Chromosome, Strand & Exon count | Chromosome: LG1 Strand: plus Exon count: 6 | |
| Gene Location within genomic sequence | Genomic accession No. NC_024126.1 Gene Start and end within genomic accession: 99064 ...... 101797 | |
| CDS Sequence | 103325166 | |
| Marker Information | ||
| Marker Type | PGTM | |
| Repeat type & sequence | Repeat type: Repeat sequence: | |
| Repeat start & end within CDS | Repeat start: Repeat end: | |
| Forward primer | Primer sequence: CAACAGGCCAGTTCCAGCTA Tm(°C): 59.963 GC (%): 55 Size: 20 | |
| Reverse primer | Primer sequence: GCCTTCCTGATGCCACAGAT Tm(°C): 60.107 GC (%): 55 Size: 20 | |
| Primer start, end within sequence and product size | Start: 263 End: 387 Product size (bp): 125 | |
| JBrowse View | JBrowse | |