Statistics
Number of enzymes: 1
Total Number of designed primers: 4
Number of PGTM primers: 3
Number of PMTM primers: 1
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103337692 NCBI Gene Symbol: LOC103337692 |
| Gene Aliases | |
| Gene description & Other designations | Description: V-type proton ATPase subunit E-like Other designations: V-type proton ATPase subunit E-like |
| Chromosome, Strand & Exon count | Chromosome: LG7 Strand: plus Exon count: 6 |
| Gene Location within genomic sequence | Genomic accession No. NC_024132.1 Gene Start and end within genomic accession: 10422788 ...... 10425357 |
| CDS Sequence | 103337692 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Compound Repeat sequence: (GAA)3ttcaacattgagaagttgcagctggtcgaggctg(AGA)4 |
| Repeat start & end within CDS | Repeat start: 97 Repeat end: 151 |
| Forward primer | Primer sequence: AAAGGCCAACGAGATCTCCG Tm(°C): 60.108 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: GGACGTCGACTTGCTTCTCT Tm(°C): 59.759 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 68 End: 192 Product size (bp): 125 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103337692 NCBI Gene Symbol: LOC103337692 |
| Gene Aliases | |
| Gene description & Other designations | Description: V-type proton ATPase subunit E-like Other designations: V-type proton ATPase subunit E-like |
| Chromosome, Strand & Exon count | Chromosome: LG7 Strand: plus Exon count: 6 |
| Gene Location within genomic sequence | Genomic accession No. NC_024132.1 Gene Start and end within genomic accession: 10422788 ...... 10425357 |
| CDS Sequence | 103337692 |
| Marker Information | |
| Marker Type | PGTM |
| Repeat type & sequence | Repeat type: Repeat sequence: |
| Repeat start & end within CDS | Repeat start: Repeat end: |
| Forward primer | Primer sequence: AAAGGCCAACGAGATCTCCG Tm(°C): 60.108 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: CGAAACAGCCTCCACCAGAT Tm(°C): 60.036 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 68 End: 437 Product size (bp): 370 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103338483 NCBI Gene Symbol: LOC103338483 |
| Gene Aliases | |
| Gene description & Other designations | Description: V-type proton ATPase subunit E-like Other designations: V-type proton ATPase subunit E-like |
| Chromosome, Strand & Exon count | Chromosome: LG7 Strand: plus Exon count: 3 |
| Gene Location within genomic sequence | Genomic accession No. NC_024132.1 Gene Start and end within genomic accession: 14844180 ...... 14845814 |
| CDS Sequence | 103338483 |
| Marker Information | |
| Marker Type | PGTM |
| Repeat type & sequence | Repeat type: Repeat sequence: |
| Repeat start & end within CDS | Repeat start: Repeat end: |
| Forward primer | Primer sequence: ACCAGCCCTTAAATCCCAGC Tm(°C): 60.033 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: TGATACGGCGATCTCGTTGG Tm(°C): 59.97 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 52 End: 158 Product size (bp): 107 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103342694 NCBI Gene Symbol: LOC103342694 |
| Gene Aliases | |
| Gene description & Other designations | Description: V-type proton ATPase subunit E2 Other designations: V-type proton ATPase subunit E2 |
| Chromosome, Strand & Exon count | Chromosome: LG1 Strand: minus Exon count: 7 |
| Gene Location within genomic sequence | Genomic accession No. NC_024126.1 Gene Start and end within genomic accession: 22607070 ...... 22608828 |
| CDS Sequence | 103342694 |
| Marker Information | |
| Marker Type | PGTM |
| Repeat type & sequence | Repeat type: Repeat sequence: |
| Repeat start & end within CDS | Repeat start: Repeat end: |
| Forward primer | Primer sequence: AAGAGGCCGAAGAGAAAGCC Tm(°C): 60.036 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: TGTCATCCGAAACACGCAGA Tm(°C): 59.967 GC (%): 50 Size: 20 |
| Primer start, end within sequence and product size | Start: 55 End: 318 Product size (bp): 264 |
| JBrowse View | JBrowse |
