image


Statistics

Number of enzymes: 1
Total Number of designed primers: 5
Number of PGTM primers:     1
Number of PMTM primers:     4
Number of Failed designed PMTM primers: 2

Enzyme Id:  K02149
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103328746     NCBI Gene Symbol: LOC103328746
Gene Aliases
Gene description & Other designations Description:   V-type proton ATPase subunit D      Other designations:   V-type proton ATPase subunit D
Chromosome, Strand & Exon count Chromosome:   LG4     Strand:   plus     Exon count:   2
Gene Location within genomic sequence Genomic accession No. NC_024129.1      Gene Start and end within genomic accession: 13791737 ...... 13793941
CDS Sequence 103328746
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Compound     Repeat sequence: (TGCTC)2(AAG)3
Repeat start & end within CDS Repeat start: 93     Repeat end: 111
Forward primer Primer sequence:   GCCAGCGCTTGACTGTAGTT     Tm(°C): 60.951     GC (%): 55     Size: 20
Reverse primer Primer sequence:   CACCAGCAACGTTCTCTTGC     Tm(°C): 60.041     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 13     End: 315     Product size (bp): 303
JBrowse View      JBrowse

Enzyme Id:  K02149
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103328746     NCBI Gene Symbol: LOC103328746
Gene Aliases
Gene description & Other designations Description:   V-type proton ATPase subunit D      Other designations:   V-type proton ATPase subunit D
Chromosome, Strand & Exon count Chromosome:   LG4     Strand:   plus     Exon count:   2
Gene Location within genomic sequence Genomic accession No. NC_024129.1      Gene Start and end within genomic accession: 13791737 ...... 13793941
CDS Sequence 103328746
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (CTTCA)2
Repeat start & end within CDS Repeat start: 452     Repeat end: 461
Forward primer Primer sequence:   CAACTCTGTCGTGCTGCCTA     Tm(°C): 60.038     GC (%): 55     Size: 20
Reverse primer Primer sequence:   CCAGTTCATCCAACTCCCCC     Tm(°C): 60.034     GC (%): 60     Size: 20
Primer start, end within sequence and product size Start: 399     End: 588     Product size (bp): 190
JBrowse View      JBrowse

Enzyme Id:  K02149
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103328746     NCBI Gene Symbol: LOC103328746
Gene Aliases
Gene description & Other designations Description:   V-type proton ATPase subunit D      Other designations:   V-type proton ATPase subunit D
Chromosome, Strand & Exon count Chromosome:   LG4     Strand:   plus     Exon count:   2
Gene Location within genomic sequence Genomic accession No. NC_024129.1      Gene Start and end within genomic accession: 13791737 ...... 13793941
CDS Sequence 103328746
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (GAT)3
Repeat start & end within CDS Repeat start: 766     Repeat end: 774
Forward primer Primer sequence:   None     Tm(°C):      GC (%):      Size:
Reverse primer Primer sequence:   None     Tm(°C):      GC (%):      Size:
Primer start, end within sequence and product size Start:      End:      Product size (bp):
JBrowse View      JBrowse

Enzyme Id:  K02149
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103328746     NCBI Gene Symbol: LOC103328746
Gene Aliases
Gene description & Other designations Description:   V-type proton ATPase subunit D      Other designations:   V-type proton ATPase subunit D
Chromosome, Strand & Exon count Chromosome:   LG4     Strand:   plus     Exon count:   2
Gene Location within genomic sequence Genomic accession No. NC_024129.1      Gene Start and end within genomic accession: 13791737 ...... 13793941
CDS Sequence 103328746
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   CAACTCTGTCGTGCTGCCTA     Tm(°C): 60.038     GC (%): 55     Size: 20
Reverse primer Primer sequence:   CCAGTTCATCCAACTCCCCC     Tm(°C): 60.034     GC (%): 60     Size: 20
Primer start, end within sequence and product size Start: 399     End: 588     Product size (bp): 190
JBrowse View      JBrowse

Enzyme Id:  K02149
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103328747     NCBI Gene Symbol: LOC103328747
Gene Aliases
Gene description & Other designations Description:   V-type proton ATPase subunit D-like      Other designations:   V-type proton ATPase subunit D-like
Chromosome, Strand & Exon count Chromosome:   LG4     Strand:   plus     Exon count:   2
Gene Location within genomic sequence Genomic accession No. NC_024129.1      Gene Start and end within genomic accession: 13807586 ...... 13809790
CDS Sequence 103328747
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Compound     Repeat sequence: (TGCTC)2(AAG)3
Repeat start & end within CDS Repeat start: 93     Repeat end: 111
Forward primer Primer sequence:   GCCAGCGCTTGACTGTAGTT     Tm(°C): 60.951     GC (%): 55     Size: 20
Reverse primer Primer sequence:   CACCAGCAACGTTCTCTTGC     Tm(°C): 60.041     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 13     End: 315     Product size (bp): 303
JBrowse View      JBrowse

Enzyme Id:  K02149
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103328747     NCBI Gene Symbol: LOC103328747
Gene Aliases
Gene description & Other designations Description:   V-type proton ATPase subunit D-like      Other designations:   V-type proton ATPase subunit D-like
Chromosome, Strand & Exon count Chromosome:   LG4     Strand:   plus     Exon count:   2
Gene Location within genomic sequence Genomic accession No. NC_024129.1      Gene Start and end within genomic accession: 13807586 ...... 13809790
CDS Sequence 103328747
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (CTTCA)2
Repeat start & end within CDS Repeat start: 452     Repeat end: 461
Forward primer Primer sequence:   CAACTCTGTCGTGCTGCCTA     Tm(°C): 60.038     GC (%): 55     Size: 20
Reverse primer Primer sequence:   CCAGTTCATCCAACTCCCCC     Tm(°C): 60.034     GC (%): 60     Size: 20
Primer start, end within sequence and product size Start: 399     End: 588     Product size (bp): 190
JBrowse View      JBrowse

Enzyme Id:  K02149
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103328747     NCBI Gene Symbol: LOC103328747
Gene Aliases
Gene description & Other designations Description:   V-type proton ATPase subunit D-like      Other designations:   V-type proton ATPase subunit D-like
Chromosome, Strand & Exon count Chromosome:   LG4     Strand:   plus     Exon count:   2
Gene Location within genomic sequence Genomic accession No. NC_024129.1      Gene Start and end within genomic accession: 13807586 ...... 13809790
CDS Sequence 103328747
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (GAT)3
Repeat start & end within CDS Repeat start: 766     Repeat end: 774
Forward primer Primer sequence:   None     Tm(°C):      GC (%):      Size:
Reverse primer Primer sequence:   None     Tm(°C):      GC (%):      Size:
Primer start, end within sequence and product size Start:      End:      Product size (bp):
JBrowse View      JBrowse