image


Statistics

Number of enzymes: 1
Total Number of designed primers: 4
Number of PGTM primers:     1
Number of PMTM primers:     3

Enzyme Id:  K02147
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103334857     NCBI Gene Symbol: LOC103334857
Gene Aliases
Gene description & Other designations Description:   V-type proton ATPase subunit B2      Other designations:   V-type proton ATPase subunit B2
Chromosome, Strand & Exon count Chromosome:   LG6     Strand:   plus     Exon count:   15
Gene Location within genomic sequence Genomic accession No. NC_024131.1      Gene Start and end within genomic accession: 5607110 ...... 5612029
CDS Sequence 103334857
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (CTG)3
Repeat start & end within CDS Repeat start: 500     Repeat end: 508
Forward primer Primer sequence:   ACAAGTACACCACCGTGCAA     Tm(°C): 60.108     GC (%): 50     Size: 20
Reverse primer Primer sequence:   CAACCGCTTGACCAAACCAG     Tm(°C): 59.969     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 241     End: 569     Product size (bp): 329
JBrowse View      JBrowse

Enzyme Id:  K02147
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103334857     NCBI Gene Symbol: LOC103334857
Gene Aliases
Gene description & Other designations Description:   V-type proton ATPase subunit B2      Other designations:   V-type proton ATPase subunit B2
Chromosome, Strand & Exon count Chromosome:   LG6     Strand:   plus     Exon count:   15
Gene Location within genomic sequence Genomic accession No. NC_024131.1      Gene Start and end within genomic accession: 5607110 ...... 5612029
CDS Sequence 103334857
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Hexa     Repeat sequence: (TGTGGA)2
Repeat start & end within CDS Repeat start: 597     Repeat end: 608
Forward primer Primer sequence:   CTGGTTTGGTCAAGCGGTTG     Tm(°C): 59.969     GC (%): 55     Size: 20
Reverse primer Primer sequence:   CAGGCACTTCTTCTCGAGCA     Tm(°C): 60.038     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 550     End: 894     Product size (bp): 345
JBrowse View      JBrowse

Enzyme Id:  K02147
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103334857     NCBI Gene Symbol: LOC103334857
Gene Aliases
Gene description & Other designations Description:   V-type proton ATPase subunit B2      Other designations:   V-type proton ATPase subunit B2
Chromosome, Strand & Exon count Chromosome:   LG6     Strand:   plus     Exon count:   15
Gene Location within genomic sequence Genomic accession No. NC_024131.1      Gene Start and end within genomic accession: 5607110 ...... 5612029
CDS Sequence 103334857
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (CACCC)2
Repeat start & end within CDS Repeat start: 1027     Repeat end: 1036
Forward primer Primer sequence:   TGGCACAAATCTACGAGCGT     Tm(°C): 60.038     GC (%): 50     Size: 20
Reverse primer Primer sequence:   GCGAGTCATCCCTTCACCAA     Tm(°C): 60.036     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 931     End: 1175     Product size (bp): 245
JBrowse View      JBrowse

Enzyme Id:  K02147
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103334857     NCBI Gene Symbol: LOC103334857
Gene Aliases
Gene description & Other designations Description:   V-type proton ATPase subunit B2      Other designations:   V-type proton ATPase subunit B2
Chromosome, Strand & Exon count Chromosome:   LG6     Strand:   plus     Exon count:   15
Gene Location within genomic sequence Genomic accession No. NC_024131.1      Gene Start and end within genomic accession: 5607110 ...... 5612029
CDS Sequence 103334857
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   AACTCGACGTGGTCAAGTCC     Tm(°C): 59.968     GC (%): 55     Size: 20
Reverse primer Primer sequence:   CAACCGCTTGACCAAACCAG     Tm(°C): 59.969     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 161     End: 569     Product size (bp): 409
JBrowse View      JBrowse