Statistics
Number of enzymes: 1
Total Number of designed primers: 2
Number of PGTM primers: 1
Number of PMTM primers: 1
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103329976 NCBI Gene Symbol: LOC103329976 |
| Gene Aliases | |
| Gene description & Other designations | Description: V-type proton ATPase subunit d2 Other designations: V-type proton ATPase subunit d2 |
| Chromosome, Strand & Exon count | Chromosome: LG4 Strand: minus Exon count: 11 |
| Gene Location within genomic sequence | Genomic accession No. NC_024129.1 Gene Start and end within genomic accession: 21717215 ...... 21720848 |
| CDS Sequence | 103329976 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Compound Repeat sequence: (TACAT)2atggccacatgatagacaatgttgtcctgattgttactggaaccttg
cat(GA)4 |
| Repeat start & end within CDS | Repeat start: 295 Repeat end: 362 |
| Forward primer | Primer sequence: ATGAACCGTCCCCATTGCAT Tm(°C): 60.033 GC (%): 50 Size: 20 |
| Reverse primer | Primer sequence: CAAACATGCCCAAAGGGTGG Tm(°C): 59.965 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 178 End: 405 Product size (bp): 228 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103329976 NCBI Gene Symbol: LOC103329976 |
| Gene Aliases | |
| Gene description & Other designations | Description: V-type proton ATPase subunit d2 Other designations: V-type proton ATPase subunit d2 |
| Chromosome, Strand & Exon count | Chromosome: LG4 Strand: minus Exon count: 11 |
| Gene Location within genomic sequence | Genomic accession No. NC_024129.1 Gene Start and end within genomic accession: 21717215 ...... 21720848 |
| CDS Sequence | 103329976 |
| Marker Information | |
| Marker Type | PGTM |
| Repeat type & sequence | Repeat type: Repeat sequence: |
| Repeat start & end within CDS | Repeat start: Repeat end: |
| Forward primer | Primer sequence: TTCAACATTCACGGCGGGTA Tm(°C): 59.965 GC (%): 50 Size: 20 |
| Reverse primer | Primer sequence: ATGCAATGGGGACGGTTCAT Tm(°C): 60.033 GC (%): 50 Size: 20 |
| Primer start, end within sequence and product size | Start: 24 End: 197 Product size (bp): 174 |
| JBrowse View | JBrowse |
